EMAIL THIS PAGE TO A FRIEND

LOC400943

40 Gene Product Result for
Species: Human LOC400943(400943)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207480 Rosetta Predictions human pricing
XR_041686 Rosetta Predictions human pricing
XR_041687 Rosetta Predictions human pricing
XR_041688 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209860 predicted 2379
2 SASI_Hs01_00209861 predicted 2014
3 SASI_Hs01_00209862 predicted 1887
4 SASI_Hs01_00209863 predicted 2363
5 SASI_Hs01_00209864 predicted 2006
6 SASI_Hs01_00209865 predicted 1810
7 SASI_Hs01_00209866 predicted 1810
8 SASI_Hs01_00209867 predicted 1800
9 SASI_Hs01_00209868 predicted 1964
10 SASI_Hs01_00209869 predicted 1983
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529579 predicted 226
2 SASI_Hs02_00529580 predicted 103
3 SASI_Hs02_00529581 predicted 220
4 SASI_Hs02_00529582 predicted 217
5 SASI_Hs02_00529583 predicted 19
6 SASI_Hs02_00529584 predicted 17
7 SASI_Hs02_00529585 predicted 168
8 SASI_Hs02_00529586 predicted 189
9 SASI_Hs02_00529587 predicted 175
10 SASI_Hs02_00529588 predicted 193
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529589 predicted 224
2 SASI_Hs02_00529590 predicted 108
3 SASI_Hs02_00529591 predicted 220
4 SASI_Hs02_00529592 predicted 220
5 SASI_Hs02_00529593 predicted 14
6 SASI_Hs02_00529594 predicted 16
7 SASI_Hs02_00529595 predicted 175
8 SASI_Hs02_00529596 predicted 193
9 SASI_Hs02_00529597 predicted 172
10 SASI_Hs02_00529598 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529599 predicted 229
2 SASI_Hs02_00529600 predicted 103
3 SASI_Hs02_00529601 predicted 20
4 SASI_Hs02_00529602 predicted 215
5 SASI_Hs02_00529603 predicted 222
6 SASI_Hs02_00529604 predicted 171
7 SASI_Hs02_00529605 predicted 15
8 SASI_Hs02_00529606 predicted 189
9 SASI_Hs02_00529607 predicted 172
10 SASI_Hs02_00529608 predicted 197
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207480
LOC400943 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207480.1-2204s1c1
Sequence:CCGGGCAAAGATCCAGGCCAGAAATCTCGAGATTTCTGGCCTGGATCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-2018s1c1
Sequence:CCGGCTATGGTGTAATTTGAGGTCACTCGAGTGACCTCAAATTACACCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-1858s1c1
Sequence:CCGGGAGTCTTTCTTCTTGGAAACACTCGAGTGTTTCCAAGAAGAAAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207480.1-2098s1c1
Sequence:CCGGCTGAGCAGAGTCCTAATTTATCTCGAGATAAATTAGGACTCTGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-1936s1c1
Sequence:CCGGCAAAGGCATTTATTACCGGAACTCGAGTTCCGGTAATAAATGCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207480.1-2191s1c1
Sequence:CCGGCAGTTGGGTTACTGCAAAGATCTCGAGATCTTTGCAGTAACCCAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207480.1-1892s1c1
Sequence:CCGGGCAAACGTCTCCAACATGACTCTCGAGAGTCATGTTGGAGACGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207480
LOC400943 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207480.1-2204s1c1
Sequence:CCGGGCAAAGATCCAGGCCAGAAATCTCGAGATTTCTGGCCTGGATCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-2018s1c1
Sequence:CCGGCTATGGTGTAATTTGAGGTCACTCGAGTGACCTCAAATTACACCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-1858s1c1
Sequence:CCGGGAGTCTTTCTTCTTGGAAACACTCGAGTGTTTCCAAGAAGAAAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207480.1-2098s1c1
Sequence:CCGGCTGAGCAGAGTCCTAATTTATCTCGAGATAAATTAGGACTCTGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-1936s1c1
Sequence:CCGGCAAAGGCATTTATTACCGGAACTCGAGTTCCGGTAATAAATGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207480.1-2191s1c1
Sequence:CCGGCAGTTGGGTTACTGCAAAGATCTCGAGATCTTTGCAGTAACCCAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207480.1-1892s1c1
Sequence:CCGGGCAAACGTCTCCAACATGACTCTCGAGAGTCATGTTGGAGACGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207480
LOC400943 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207480.1-2204s1c1
Sequence:CCGGGCAAAGATCCAGGCCAGAAATCTCGAGATTTCTGGCCTGGATCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-2018s1c1
Sequence:CCGGCTATGGTGTAATTTGAGGTCACTCGAGTGACCTCAAATTACACCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-1858s1c1
Sequence:CCGGGAGTCTTTCTTCTTGGAAACACTCGAGTGTTTCCAAGAAGAAAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207480.1-2098s1c1
Sequence:CCGGCTGAGCAGAGTCCTAATTTATCTCGAGATAAATTAGGACTCTGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207480.1-1936s1c1
Sequence:CCGGCAAAGGCATTTATTACCGGAACTCGAGTTCCGGTAATAAATGCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207480.1-2191s1c1
Sequence:CCGGCAGTTGGGTTACTGCAAAGATCTCGAGATCTTTGCAGTAACCCAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207480.1-1892s1c1
Sequence:CCGGGCAAACGTCTCCAACATGACTCTCGAGAGTCATGTTGGAGACGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)