EMAIL THIS PAGE TO A FRIEND

LOC400965

10 Gene Product Result for
Species: Human LOC400965(400965)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013677 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021340 predicted 244
2 SASI_Hs01_00021341 predicted 810
3 SASI_Hs01_00021342 predicted 474
4 SASI_Hs01_00021343 predicted 531
5 SASI_Hs01_00021344 predicted 775
6 SASI_Hs01_00021345 predicted 938
7 SASI_Hs01_00021346 predicted 540
8 SASI_Hs01_00021347 predicted 954
9 SASI_Hs01_00021348 predicted 820
10 SASI_Hs01_00021349 predicted 249
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013677
LOC400965 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-547s1c1
Sequence:CCGGGTCTGTATTGTCTTCCTAGCTCTCGAGAGCTAGGAAGACAATACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-216s1c1
Sequence:CCGGCCACTCTTTATTGTCCTACCTCTCGAGAGGTAGGACAATAAAGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-471s1c1
Sequence:CCGGGTCTTATATTGATGTACCCTTCTCGAGAAGGGTACATCAATATAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-400s1c1
Sequence:CCGGCTTGAAACATATGCAGACCAACTCGAGTTGGTCTGCATATGTTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013677.1-748s1c1
Sequence:CCGGGCAAATGGAATATGCTGAGAACTCGAGTTCTCAGCATATTCCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-399s1c1
Sequence:CCGGCCTTGAAACATATGCAGACCACTCGAGTGGTCTGCATATGTTTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-533s1c1
Sequence:CCGGCAGGCAACATGAGAGTCTGTACTCGAGTACAGACTCTCATGTTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-396s1c1
Sequence:CCGGGAGCCTTGAAACATATGCAGACTCGAGTCTGCATATGTTTCAAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013677
LOC400965 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-547s1c1
Sequence:CCGGGTCTGTATTGTCTTCCTAGCTCTCGAGAGCTAGGAAGACAATACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-216s1c1
Sequence:CCGGCCACTCTTTATTGTCCTACCTCTCGAGAGGTAGGACAATAAAGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-471s1c1
Sequence:CCGGGTCTTATATTGATGTACCCTTCTCGAGAAGGGTACATCAATATAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-400s1c1
Sequence:CCGGCTTGAAACATATGCAGACCAACTCGAGTTGGTCTGCATATGTTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013677.1-748s1c1
Sequence:CCGGGCAAATGGAATATGCTGAGAACTCGAGTTCTCAGCATATTCCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-399s1c1
Sequence:CCGGCCTTGAAACATATGCAGACCACTCGAGTGGTCTGCATATGTTTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-533s1c1
Sequence:CCGGCAGGCAACATGAGAGTCTGTACTCGAGTACAGACTCTCATGTTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-396s1c1
Sequence:CCGGGAGCCTTGAAACATATGCAGACTCGAGTCTGCATATGTTTCAAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013677
LOC400965 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-547s1c1
Sequence:CCGGGTCTGTATTGTCTTCCTAGCTCTCGAGAGCTAGGAAGACAATACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168170    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-216s1c1
Sequence:CCGGCCACTCTTTATTGTCCTACCTCTCGAGAGGTAGGACAATAAAGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-471s1c1
Sequence:CCGGGTCTTATATTGATGTACCCTTCTCGAGAAGGGTACATCAATATAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-400s1c1
Sequence:CCGGCTTGAAACATATGCAGACCAACTCGAGTTGGTCTGCATATGTTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167519    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013677.1-748s1c1
Sequence:CCGGGCAAATGGAATATGCTGAGAACTCGAGTTCTCAGCATATTCCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-399s1c1
Sequence:CCGGCCTTGAAACATATGCAGACCACTCGAGTGGTCTGCATATGTTTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-533s1c1
Sequence:CCGGCAGGCAACATGAGAGTCTGTACTCGAGTACAGACTCTCATGTTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013677.1-396s1c1
Sequence:CCGGGAGCCTTGAAACATATGCAGACTCGAGTCTGCATATGTTTCAAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)