EMAIL THIS PAGE TO A FRIEND

LOC400968

25 Gene Product Result for
Species: Human LOC400968(400968)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013678 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013678 Rosetta Predictions human pricing
XR_041699 Rosetta Predictions human pricing
XR_041700 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123509 predicted 3449
2 SASI_Hs01_00123510 predicted 3447
3 SASI_Hs01_00123511 predicted 3433
4 SASI_Hs01_00123512 predicted 3439
5 SASI_Hs01_00123513 predicted 3437
6 SASI_Hs01_00123514 predicted 2973
7 SASI_Hs01_00123515 predicted 3242
8 SASI_Hs01_00123516 predicted 3239
9 SASI_Hs01_00123517 predicted 3231
10 SASI_Hs01_00123518 predicted 2946
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529679 predicted 268
2 SASI_Hs02_00529680 predicted 266
3 SASI_Hs02_00529681 predicted 260
4 SASI_Hs02_00529682 predicted 297
5 SASI_Hs02_00529683 predicted 540
6 SASI_Hs02_00529684 predicted 549
7 SASI_Hs02_00529685 predicted 283
8 SASI_Hs02_00529686 predicted 278
9 SASI_Hs02_00529687 predicted 588
10 SASI_Hs02_00529688 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529689 predicted 542
2 SASI_Hs02_00529690 predicted 552
3 SASI_Hs02_00529691 predicted 584
4 SASI_Hs02_00529692 predicted 548
5 SASI_Hs02_00529693 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013678
LOC400968 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000168733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4389s1c1
Sequence:CCGGGCAGTACAAAGGCAGAGATTTCTCGAGAAATCTCTGCCTTTGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4296s1c1
Sequence:CCGGGCGGGTCAATGAAGATACTAACTCGAGTTAGTATCTTCATTGACCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4190s1c1
Sequence:CCGGCTTCTTTCACTACAAAGGAATCTCGAGATTCCTTTGTAGTGAAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4265s1c1
Sequence:CCGGGTTAAACACTACCCTCCTGAACTCGAGTTCAGGAGGGTAGTGTTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013678
LOC400968 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000168733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4389s1c1
Sequence:CCGGGCAGTACAAAGGCAGAGATTTCTCGAGAAATCTCTGCCTTTGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4296s1c1
Sequence:CCGGGCGGGTCAATGAAGATACTAACTCGAGTTAGTATCTTCATTGACCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4190s1c1
Sequence:CCGGCTTCTTTCACTACAAAGGAATCTCGAGATTCCTTTGTAGTGAAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4265s1c1
Sequence:CCGGGTTAAACACTACCCTCCTGAACTCGAGTTCAGGAGGGTAGTGTTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013678
LOC400968 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000168733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4389s1c1
Sequence:CCGGGCAGTACAAAGGCAGAGATTTCTCGAGAAATCTCTGCCTTTGTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4296s1c1
Sequence:CCGGGCGGGTCAATGAAGATACTAACTCGAGTTAGTATCTTCATTGACCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4190s1c1
Sequence:CCGGCTTCTTTCACTACAAAGGAATCTCGAGATTCCTTTGTAGTGAAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013678.1-4265s1c1
Sequence:CCGGGTTAAACACTACCCTCCTGAACTCGAGTTCAGGAGGGTAGTGTTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)