EMAIL THIS PAGE TO A FRIEND

LOC401052

13 Gene Product Result for
Species: Human LOC401052(401052)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008737 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102571 MISSION® esiRNA esiRNA human AC022007.5-203 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008737 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168730 predicted 1279
2 SASI_Hs01_00168731 predicted 1269
3 SASI_Hs01_00168732 predicted 1279
4 SASI_Hs01_00168733 predicted 1176
5 SASI_Hs01_00168734 predicted 1195
6 SASI_Hs01_00168735 predicted 1286
7 SASI_Hs01_00168736 predicted 1286
8 SASI_Hs01_00168737 predicted 747
9 SASI_Hs01_00168738 predicted 956
10 SASI_Hs01_00168739 predicted 914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008737
LOC401052 MISSION shRNA Bacterial Glycerol Stock
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-643s1c1
Sequence:CCGGCAAAGGGAGATGAACAAGCCACTCGAGTGGCTTGTTCATCTCCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-817s1c1
Sequence:CCGGCATCGAAGCAGAAAGGCCAATCTCGAGATTGGCCTTTCTGCTTCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164604    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1698s1c1
Sequence:CCGGCCATCGATCTACTTGCTACTTCTCGAGAAGTAGCAAGTAGATCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1625s1c1
Sequence:CCGGCCTGAGACTTTGGTCCTTTAACTCGAGTTAAAGGACCAAAGTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-809s1c1
Sequence:CCGGGAAGAAACCATCGAAGCAGAACTCGAGTTCTGCTTCGATGGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1702s1c1
Sequence:CCGGCGATCTACTTGCTACTTCTATCTCGAGATAGAAGTAGCAAGTAGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-786s1c1
Sequence:CCGGGCTTCATGCCACTGTTATCAACTCGAGTTGATAACAGTGGCATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1624s1c1
Sequence:CCGGCCCTGAGACTTTGGTCCTTTACTCGAGTAAAGGACCAAAGTCTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008737.1-783s21c1
Sequence:CCGGAGCGCTTCATGCCACTGTTATCTCGAGATAACAGTGGCATGAAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008737.1-956s21c1
Sequence:CCGGGGACCTCTCAGCATGATTGACCTCGAGGTCAATCATGCTGAGAGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008737.1-1312s21c1
Sequence:CCGGTTGCAAGAACCGGTCACTTATCTCGAGATAAGTGACCGGTTCTTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008737
LOC401052 MISSION shRNA shRNA Plasmid DNA
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-643s1c1
Sequence:CCGGCAAAGGGAGATGAACAAGCCACTCGAGTGGCTTGTTCATCTCCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-817s1c1
Sequence:CCGGCATCGAAGCAGAAAGGCCAATCTCGAGATTGGCCTTTCTGCTTCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164604    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1698s1c1
Sequence:CCGGCCATCGATCTACTTGCTACTTCTCGAGAAGTAGCAAGTAGATCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1625s1c1
Sequence:CCGGCCTGAGACTTTGGTCCTTTAACTCGAGTTAAAGGACCAAAGTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-809s1c1
Sequence:CCGGGAAGAAACCATCGAAGCAGAACTCGAGTTCTGCTTCGATGGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1702s1c1
Sequence:CCGGCGATCTACTTGCTACTTCTATCTCGAGATAGAAGTAGCAAGTAGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-786s1c1
Sequence:CCGGGCTTCATGCCACTGTTATCAACTCGAGTTGATAACAGTGGCATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1624s1c1
Sequence:CCGGCCCTGAGACTTTGGTCCTTTACTCGAGTAAAGGACCAAAGTCTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008737.1-783s21c1
Sequence:CCGGAGCGCTTCATGCCACTGTTATCTCGAGATAACAGTGGCATGAAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008737.1-956s21c1
Sequence:CCGGGGACCTCTCAGCATGATTGACCTCGAGGTCAATCATGCTGAGAGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008737.1-1312s21c1
Sequence:CCGGTTGCAAGAACCGGTCACTTATCTCGAGATAAGTGACCGGTTCTTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008737
LOC401052 MISSION shRNA Lentiviral Transduction Particles
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-643s1c1
Sequence:CCGGCAAAGGGAGATGAACAAGCCACTCGAGTGGCTTGTTCATCTCCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-817s1c1
Sequence:CCGGCATCGAAGCAGAAAGGCCAATCTCGAGATTGGCCTTTCTGCTTCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164604    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1698s1c1
Sequence:CCGGCCATCGATCTACTTGCTACTTCTCGAGAAGTAGCAAGTAGATCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163836    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1625s1c1
Sequence:CCGGCCTGAGACTTTGGTCCTTTAACTCGAGTTAAAGGACCAAAGTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-809s1c1
Sequence:CCGGGAAGAAACCATCGAAGCAGAACTCGAGTTCTGCTTCGATGGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162208    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1702s1c1
Sequence:CCGGCGATCTACTTGCTACTTCTATCTCGAGATAGAAGTAGCAAGTAGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008737.1-786s1c1
Sequence:CCGGGCTTCATGCCACTGTTATCAACTCGAGTTGATAACAGTGGCATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008737.1-1624s1c1
Sequence:CCGGCCCTGAGACTTTGGTCCTTTACTCGAGTAAAGGACCAAAGTCTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008737.1-783s21c1
Sequence:CCGGAGCGCTTCATGCCACTGTTATCTCGAGATAACAGTGGCATGAAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001008737.1-956s21c1
Sequence:CCGGGGACCTCTCAGCATGATTGACCTCGAGGTCAATCATGCTGAGAGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008737.1-1312s21c1
Sequence:CCGGTTGCAAGAACCGGTCACTTATCTCGAGATAAGTGACCGGTTCTTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)