EMAIL THIS PAGE TO A FRIEND

LOC401286

40 Gene Product Result for
Species: Human LOC401286(401286)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001023565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001023565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001023565 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023565 Rosetta Predictions human pricing
XR_040756 Rosetta Predictions human pricing
XR_040757 Rosetta Predictions human pricing
XR_040758 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011046 predicted 2186
2 SASI_Hs01_00011047 predicted 2638
3 SASI_Hs01_00011048 predicted 2592
4 SASI_Hs01_00011049 predicted 1788
5 SASI_Hs01_00011050 predicted 2559
6 SASI_Hs01_00011051 predicted 2272
7 SASI_Hs01_00011052 predicted 2165
8 SASI_Hs01_00011053 predicted 2567
9 SASI_Hs01_00011054 predicted 2504
10 SASI_Hs01_00011055 predicted 2698
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521661 predicted 318
2 SASI_Hs02_00521662 predicted 270
3 SASI_Hs02_00521663 predicted 300
4 SASI_Hs02_00521664 predicted 285
5 SASI_Hs02_00521665 predicted 235
6 SASI_Hs02_00521666 predicted 303
7 SASI_Hs02_00521667 predicted 288
8 SASI_Hs02_00521668 predicted 299
9 SASI_Hs02_00521669 predicted 287
10 SASI_Hs02_00521670 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521671 predicted 320
2 SASI_Hs02_00521672 predicted 268
3 SASI_Hs02_00521673 predicted 304
4 SASI_Hs02_00521674 predicted 287
5 SASI_Hs02_00521675 predicted 232
6 SASI_Hs02_00521676 predicted 304
7 SASI_Hs02_00521677 predicted 296
8 SASI_Hs02_00521678 predicted 300
9 SASI_Hs02_00521679 predicted 284
10 SASI_Hs02_00521680 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521681 predicted 323
2 SASI_Hs02_00521682 predicted 264
3 SASI_Hs02_00521683 predicted 302
4 SASI_Hs02_00521684 predicted 287
5 SASI_Hs02_00521685 predicted 233
6 SASI_Hs02_00521686 predicted 301
7 SASI_Hs02_00521687 predicted 296
8 SASI_Hs02_00521688 predicted 296
9 SASI_Hs02_00521689 predicted 283
10 SASI_Hs02_00521690 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001023565
LOC401286 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000166306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023565.1-2028s1c1
Sequence:CCGGCCCAATGCCATAGATGCACTTCTCGAGAAGTGCATCTATGGCATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023565.1-1866s1c1
Sequence:CCGGCCATCTCATGACAAAGCAGTTCTCGAGAACTGCTTTGTCATGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023565.1-2604s1c1
Sequence:CCGGCGCAGCCTGTAAATGCTTAAACTCGAGTTTAAGCATTTACAGGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023565.1-2874s1c1
Sequence:CCGGGCTGCCGTTCAGTTATCTATTCTCGAGAATAGATAACTGAACGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001023565
LOC401286 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000166306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023565.1-2028s1c1
Sequence:CCGGCCCAATGCCATAGATGCACTTCTCGAGAAGTGCATCTATGGCATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023565.1-1866s1c1
Sequence:CCGGCCATCTCATGACAAAGCAGTTCTCGAGAACTGCTTTGTCATGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023565.1-2604s1c1
Sequence:CCGGCGCAGCCTGTAAATGCTTAAACTCGAGTTTAAGCATTTACAGGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023565.1-2874s1c1
Sequence:CCGGGCTGCCGTTCAGTTATCTATTCTCGAGAATAGATAACTGAACGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001023565
LOC401286 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000166306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023565.1-2028s1c1
Sequence:CCGGCCCAATGCCATAGATGCACTTCTCGAGAAGTGCATCTATGGCATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001023565.1-1866s1c1
Sequence:CCGGCCATCTCATGACAAAGCAGTTCTCGAGAACTGCTTTGTCATGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023565.1-2604s1c1
Sequence:CCGGCGCAGCCTGTAAATGCTTAAACTCGAGTTTAAGCATTTACAGGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164638    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001023565.1-2874s1c1
Sequence:CCGGGCTGCCGTTCAGTTATCTATTCTCGAGAATAGATAACTGAACGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)