EMAIL THIS PAGE TO A FRIEND

LOC401296

51 Gene Product Result for
Species: Human LOC401296(401296)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412967 Anti-LOC401296 antibody produced in mouse purified immunoglobulin human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024677 Rosetta Predictions human pricing
XR_040759 Rosetta Predictions human pricing
XR_040760 Rosetta Predictions human pricing
XR_040761 Rosetta Predictions human pricing
XR_040762 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241106 predicted 983
2 SASI_Hs01_00241107 predicted 681
3 SASI_Hs01_00241108 predicted 584
4 SASI_Hs01_00241109 predicted 578
5 SASI_Hs01_00241110 predicted 789
6 SASI_Hs01_00241111 predicted 780
7 SASI_Hs01_00241112 predicted 457
8 SASI_Hs01_00241113 predicted 830
9 SASI_Hs01_00241114 predicted 513
10 SASI_Hs01_00241115 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521691 predicted 237
2 SASI_Hs02_00521692 predicted 234
3 SASI_Hs02_00521693 predicted 344
4 SASI_Hs02_00521694 predicted 448
5 SASI_Hs02_00521695 predicted 446
6 SASI_Hs02_00521696 predicted 443
7 SASI_Hs02_00521697 predicted 331
8 SASI_Hs02_00521698 predicted 478
9 SASI_Hs02_00521699 predicted 561
10 SASI_Hs02_00521700 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521701 predicted 235
2 SASI_Hs02_00521702 predicted 233
3 SASI_Hs02_00521703 predicted 346
4 SASI_Hs02_00521704 predicted 448
5 SASI_Hs02_00521705 predicted 444
6 SASI_Hs02_00521706 predicted 442
7 SASI_Hs02_00521707 predicted 333
8 SASI_Hs02_00521708 predicted 486
9 SASI_Hs02_00521709 predicted 555
10 SASI_Hs02_00521710 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521711 predicted 238
2 SASI_Hs02_00521712 predicted 227
3 SASI_Hs02_00521713 predicted 347
4 SASI_Hs02_00521714 predicted 449
5 SASI_Hs02_00521715 predicted 444
6 SASI_Hs02_00521716 predicted 439
7 SASI_Hs02_00521717 predicted 335
8 SASI_Hs02_00521718 predicted 478
9 SASI_Hs02_00521719 predicted 555
10 SASI_Hs02_00521720 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521721 predicted 240
2 SASI_Hs02_00521722 predicted 234
3 SASI_Hs02_00521723 predicted 340
4 SASI_Hs02_00521724 predicted 447
5 SASI_Hs02_00521725 predicted 438
6 SASI_Hs02_00521726 predicted 442
7 SASI_Hs02_00521727 predicted 336
8 SASI_Hs02_00521728 predicted 479
9 SASI_Hs02_00521729 predicted 557
10 SASI_Hs02_00521730 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024677
LOC401296 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000122324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-1157s1c1
Sequence:CCGGCTGAATCCTCACAGCCTTGTTCTCGAGAACAAGGCTGTGAGGATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024677.1-723s1c1
Sequence:CCGGCCACACCACACATCGTATACTCTCGAGAGTATACGATGTGTGGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-954s1c1
Sequence:CCGGCAGTACATCCTCTCTTCCTAACTCGAGTTAGGAAGAGAGGATGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-953s1c1
Sequence:CCGGCCAGTACATCCTCTCTTCCTACTCGAGTAGGAAGAGAGGATGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024677
LOC401296 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000122324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-1157s1c1
Sequence:CCGGCTGAATCCTCACAGCCTTGTTCTCGAGAACAAGGCTGTGAGGATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024677.1-723s1c1
Sequence:CCGGCCACACCACACATCGTATACTCTCGAGAGTATACGATGTGTGGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-954s1c1
Sequence:CCGGCAGTACATCCTCTCTTCCTAACTCGAGTTAGGAAGAGAGGATGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-953s1c1
Sequence:CCGGCCAGTACATCCTCTCTTCCTACTCGAGTAGGAAGAGAGGATGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024677
LOC401296 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000122324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-1157s1c1
Sequence:CCGGCTGAATCCTCACAGCCTTGTTCTCGAGAACAAGGCTGTGAGGATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183869    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024677.1-723s1c1
Sequence:CCGGCCACACCACACATCGTATACTCTCGAGAGTATACGATGTGTGGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-954s1c1
Sequence:CCGGCAGTACATCCTCTCTTCCTAACTCGAGTTAGGAAGAGAGGATGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024677.1-953s1c1
Sequence:CCGGCCAGTACATCCTCTCTTCCTACTCGAGTAGGAAGAGAGGATGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)