EMAIL THIS PAGE TO A FRIEND

LOC401357

11 Gene Product Result for
Species: Human LOC401357(401357)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376619 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013685 Rosetta Predictions human pricing
XR_040240 Rosetta Predictions human pricing
XR_040241 Rosetta Predictions human pricing
XR_040242 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203521 predicted 627
2 SASI_Hs01_00203522 predicted 606
3 SASI_Hs01_00203523 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517141 predicted 572
2 SASI_Hs02_00517142 predicted 572
3 SASI_Hs02_00517143 predicted 667
4 SASI_Hs02_00517144 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517145 predicted 1798
2 SASI_Hs02_00517146 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517147 predicted 1798
2 SASI_Hs02_00517148 predicted 1743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376619
LOC401357 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-376s1c1
Sequence:CCGGGCCTCTACAGTCACAACATCTCTCGAGAGATGTTGTGACTGTAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-261s1c1
Sequence:CCGGCCCTGAACTTTCTCAAGTCGACTCGAGTCGACTTGAGAAAGTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-196s1c1
Sequence:CCGGGCACAGCTCCATCGTTACAATCTCGAGATTGTAACGATGGAGCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-117s1c1
Sequence:CCGGCAATGGCCTATTTAGGCCCATCTCGAGATGGGCCTAAATAGGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376619
LOC401357 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-376s1c1
Sequence:CCGGGCCTCTACAGTCACAACATCTCTCGAGAGATGTTGTGACTGTAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-261s1c1
Sequence:CCGGCCCTGAACTTTCTCAAGTCGACTCGAGTCGACTTGAGAAAGTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-196s1c1
Sequence:CCGGGCACAGCTCCATCGTTACAATCTCGAGATTGTAACGATGGAGCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-117s1c1
Sequence:CCGGCAATGGCCTATTTAGGCCCATCTCGAGATGGGCCTAAATAGGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376619
LOC401357 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-376s1c1
Sequence:CCGGGCCTCTACAGTCACAACATCTCTCGAGAGATGTTGTGACTGTAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-261s1c1
Sequence:CCGGCCCTGAACTTTCTCAAGTCGACTCGAGTCGACTTGAGAAAGTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-196s1c1
Sequence:CCGGGCACAGCTCCATCGTTACAATCTCGAGATTGTAACGATGGAGCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376619.1-117s1c1
Sequence:CCGGCAATGGCCTATTTAGGCCCATCTCGAGATGGGCCTAAATAGGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)