EMAIL THIS PAGE TO A FRIEND

LOC401410

20 Gene Product Result for
Species: Human LOC401410(401410)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008742 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008742 Rosetta Predictions human pricing
XR_040397 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108418 predicted 840
2 SASI_Hs01_00108419 predicted 543
3 SASI_Hs01_00108420 predicted 892
4 SASI_Hs01_00108421 predicted 875
5 SASI_Hs01_00108422 predicted 633
6 SASI_Hs01_00108423 predicted 916
7 SASI_Hs01_00108424 predicted 381
8 SASI_Hs01_00108425 predicted 260
9 SASI_Hs01_00108426 predicted 918
10 SASI_Hs01_00108427 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518471 predicted 201
2 SASI_Hs02_00518472 predicted 199
3 SASI_Hs02_00518473 predicted 343
4 SASI_Hs02_00518474 predicted 326
5 SASI_Hs02_00518475 predicted 214
6 SASI_Hs02_00518476 predicted 257
7 SASI_Hs02_00518477 predicted 307
8 SASI_Hs02_00518478 predicted 158
9 SASI_Hs02_00518479 predicted 262
10 SASI_Hs02_00518480 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008742
LOC401410 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-86s1c1
Sequence:CCGGCCTTCCGTGCTTGTAGGATTTCTCGAGAAATCCTACAAGCACGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008742.1-523s1c1
Sequence:CCGGCCAGAGTTTCTCTGCTCCAATCTCGAGATTGGAGCAGAGAAACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-191s1c1
Sequence:CCGGCCACATGTTCTTGAGGAAGTTCTCGAGAACTTCCTCAAGAACATGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-260s1c1
Sequence:CCGGGCACAAGAGAACACACAGCAACTCGAGTTGCTGTGTGTTCTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-154s1c1
Sequence:CCGGGATGTCTATGAATAGGACGGACTCGAGTCCGTCCTATTCATAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-146s1c1
Sequence:CCGGGCACCTCCGATGTCTATGAATCTCGAGATTCATAGACATCGGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008742
LOC401410 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-86s1c1
Sequence:CCGGCCTTCCGTGCTTGTAGGATTTCTCGAGAAATCCTACAAGCACGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008742.1-523s1c1
Sequence:CCGGCCAGAGTTTCTCTGCTCCAATCTCGAGATTGGAGCAGAGAAACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-191s1c1
Sequence:CCGGCCACATGTTCTTGAGGAAGTTCTCGAGAACTTCCTCAAGAACATGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-260s1c1
Sequence:CCGGGCACAAGAGAACACACAGCAACTCGAGTTGCTGTGTGTTCTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-154s1c1
Sequence:CCGGGATGTCTATGAATAGGACGGACTCGAGTCCGTCCTATTCATAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-146s1c1
Sequence:CCGGGCACCTCCGATGTCTATGAATCTCGAGATTCATAGACATCGGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008742
LOC401410 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-86s1c1
Sequence:CCGGCCTTCCGTGCTTGTAGGATTTCTCGAGAAATCCTACAAGCACGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001008742.1-523s1c1
Sequence:CCGGCCAGAGTTTCTCTGCTCCAATCTCGAGATTGGAGCAGAGAAACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-191s1c1
Sequence:CCGGCCACATGTTCTTGAGGAAGTTCTCGAGAACTTCCTCAAGAACATGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-260s1c1
Sequence:CCGGGCACAAGAGAACACACAGCAACTCGAGTTGCTGTGTGTTCTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-154s1c1
Sequence:CCGGGATGTCTATGAATAGGACGGACTCGAGTCCGTCCTATTCATAGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008742.1-146s1c1
Sequence:CCGGGCACCTCCGATGTCTATGAATCTCGAGATTCATAGACATCGGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)