EMAIL THIS PAGE TO A FRIEND

LOC401589

40 Gene Product Result for
Species: Human LOC401589(401589)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013687 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013687 Rosetta Predictions human pricing
XR_041731 Rosetta Predictions human pricing
XR_041732 Rosetta Predictions human pricing
XR_041733 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069352 predicted 244
2 SASI_Hs01_00069353 predicted 215
3 SASI_Hs01_00069354 predicted 351
4 SASI_Hs01_00069355 predicted 488
5 SASI_Hs01_00069356 predicted 306
6 SASI_Hs01_00069357 predicted 841
7 SASI_Hs01_00069358 predicted 262
8 SASI_Hs01_00069359 predicted 519
9 SASI_Hs01_00069360 predicted 278
10 SASI_Hs01_00069361 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529881 predicted 547
2 SASI_Hs02_00529882 predicted 240
3 SASI_Hs02_00529883 predicted 203
4 SASI_Hs02_00529884 predicted 1289
5 SASI_Hs02_00529885 predicted 468
6 SASI_Hs02_00529886 predicted 300
7 SASI_Hs02_00529887 predicted 1762
8 SASI_Hs02_00529888 predicted 310
9 SASI_Hs02_00529889 predicted 1062
10 SASI_Hs02_00529890 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529891 predicted 551
2 SASI_Hs02_00529892 predicted 232
3 SASI_Hs02_00529893 predicted 209
4 SASI_Hs02_00529894 predicted 1294
5 SASI_Hs02_00529895 predicted 476
6 SASI_Hs02_00529896 predicted 297
7 SASI_Hs02_00529897 predicted 1764
8 SASI_Hs02_00529898 predicted 307
9 SASI_Hs02_00529899 predicted 1065
10 SASI_Hs02_00529900 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00529901 predicted 551
2 SASI_Hs02_00529902 predicted 237
3 SASI_Hs02_00529903 predicted 204
4 SASI_Hs02_00529904 predicted 1290
5 SASI_Hs02_00529905 predicted 476
6 SASI_Hs02_00529906 predicted 295
7 SASI_Hs02_00529907 predicted 1760
8 SASI_Hs02_00529908 predicted 308
9 SASI_Hs02_00529909 predicted 1063
10 SASI_Hs02_00529910 predicted 484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013687
LOC401589 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-97s1c1
Sequence:CCGGCACAGCTCCTTGTCGTTGAATCTCGAGATTCAACGACAAGGAGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-310s1c1
Sequence:CCGGGCTAATGGCCTAGAGACTAAACTCGAGTTTAGTCTCTAGGCCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013687.1-354s1c1
Sequence:CCGGGAAATGTGCGTGTTCTGTCTTCTCGAGAAGACAGAACACGCACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013687.1-110s1c1
Sequence:CCGGCGTTGAATCTCGTATCACTGACTCGAGTCAGTGATACGAGATTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-104s1c1
Sequence:CCGGCCTTGTCGTTGAATCTCGTATCTCGAGATACGAGATTCAACGACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-156s1c1
Sequence:CCGGGTTGGTGATTCACTTTAGGATCTCGAGATCCTAAAGTGAATCACCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013687.1-1860s1c1
Sequence:CCGGCCTCCATTAATCTGCTTCATTCTCGAGAATGAAGCAGATTAATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013687
LOC401589 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-97s1c1
Sequence:CCGGCACAGCTCCTTGTCGTTGAATCTCGAGATTCAACGACAAGGAGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-310s1c1
Sequence:CCGGGCTAATGGCCTAGAGACTAAACTCGAGTTTAGTCTCTAGGCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013687.1-354s1c1
Sequence:CCGGGAAATGTGCGTGTTCTGTCTTCTCGAGAAGACAGAACACGCACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013687.1-110s1c1
Sequence:CCGGCGTTGAATCTCGTATCACTGACTCGAGTCAGTGATACGAGATTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-104s1c1
Sequence:CCGGCCTTGTCGTTGAATCTCGTATCTCGAGATACGAGATTCAACGACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-156s1c1
Sequence:CCGGGTTGGTGATTCACTTTAGGATCTCGAGATCCTAAAGTGAATCACCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013687.1-1860s1c1
Sequence:CCGGCCTCCATTAATCTGCTTCATTCTCGAGAATGAAGCAGATTAATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013687
LOC401589 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-97s1c1
Sequence:CCGGCACAGCTCCTTGTCGTTGAATCTCGAGATTCAACGACAAGGAGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-310s1c1
Sequence:CCGGGCTAATGGCCTAGAGACTAAACTCGAGTTTAGTCTCTAGGCCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013687.1-354s1c1
Sequence:CCGGGAAATGTGCGTGTTCTGTCTTCTCGAGAAGACAGAACACGCACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013687.1-110s1c1
Sequence:CCGGCGTTGAATCTCGTATCACTGACTCGAGTCAGTGATACGAGATTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-104s1c1
Sequence:CCGGCCTTGTCGTTGAATCTCGTATCTCGAGATACGAGATTCAACGACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013687.1-156s1c1
Sequence:CCGGGTTGGTGATTCACTTTAGGATCTCGAGATCCTAAAGTGAATCACCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013687.1-1860s1c1
Sequence:CCGGCCTCCATTAATCTGCTTCATTCTCGAGAATGAAGCAGATTAATGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)