EMAIL THIS PAGE TO A FRIEND

LOC440063

21 Gene Product Result for
Species: Human LOC440063(440063)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_495896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_495896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_495896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_016123 Rosetta Predictions human pricing
XR_018394 Rosetta Predictions human pricing
XR_039651 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_016123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00490236 predicted 453
2 SASI_Hs02_00490237 predicted 577
3 SASI_Hs02_00490238 predicted 578
4 SASI_Hs02_00490239 predicted 23
5 SASI_Hs02_00490240 predicted 525
6 SASI_Hs02_00490241 predicted 525
7 SASI_Hs02_00490242 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_018394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00496036 predicted 448
2 SASI_Hs02_00496037 predicted 578
3 SASI_Hs02_00496038 predicted 582
4 SASI_Hs02_00496039 predicted 26
5 SASI_Hs02_00496040 predicted 523
6 SASI_Hs02_00496041 predicted 525
7 SASI_Hs02_00496042 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00512378 predicted 455
2 SASI_Hs02_00512379 predicted 578
3 SASI_Hs02_00512380 predicted 578
4 SASI_Hs02_00512381 predicted 30
5 SASI_Hs02_00512382 predicted 528
6 SASI_Hs02_00512383 predicted 521
7 SASI_Hs02_00512384 predicted 562
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_495896
LOC440063 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-392s1c1
Sequence:CCGGCGTGAATATTGTGGAGGCCATCTCGAGATGGCCTCCACAATATTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-336s1c1
Sequence:CCGGGCCAAGACTGAGTGGTTGGATCTCGAGATCCAACCACTCAGTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-354s1c1
Sequence:CCGGGATGGCAAGCATGTGGTCTTTCTCGAGAAAGACCACATGCTTGCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-379s1c1
Sequence:CCGGAGGTGAAAGAAGGCGTGAATACTCGAGTATTCACGCCTTCTTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-289s1c1
Sequence:CCGGCAAATGCTGGACCCAACACAACTCGAGTTGTGTTGGGTCCAGCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_495896
LOC440063 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-392s1c1
Sequence:CCGGCGTGAATATTGTGGAGGCCATCTCGAGATGGCCTCCACAATATTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-336s1c1
Sequence:CCGGGCCAAGACTGAGTGGTTGGATCTCGAGATCCAACCACTCAGTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-354s1c1
Sequence:CCGGGATGGCAAGCATGTGGTCTTTCTCGAGAAAGACCACATGCTTGCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-379s1c1
Sequence:CCGGAGGTGAAAGAAGGCGTGAATACTCGAGTATTCACGCCTTCTTTCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-289s1c1
Sequence:CCGGCAAATGCTGGACCCAACACAACTCGAGTTGTGTTGGGTCCAGCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_495896
LOC440063 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-392s1c1
Sequence:CCGGCGTGAATATTGTGGAGGCCATCTCGAGATGGCCTCCACAATATTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-336s1c1
Sequence:CCGGGCCAAGACTGAGTGGTTGGATCTCGAGATCCAACCACTCAGTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-354s1c1
Sequence:CCGGGATGGCAAGCATGTGGTCTTTCTCGAGAAAGACCACATGCTTGCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-379s1c1
Sequence:CCGGAGGTGAAAGAAGGCGTGAATACTCGAGTATTCACGCCTTCTTTCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_495896.1-289s1c1
Sequence:CCGGCAAATGCTGGACCCAACACAACTCGAGTTGTGTTGGGTCCAGCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)