EMAIL THIS PAGE TO A FRIEND

LOC440082

30 Gene Product Result for
Species: Human LOC440082(440082)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013697 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040644 Rosetta Predictions human pricing
XR_040645 Rosetta Predictions human pricing
XR_040646 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520677 predicted 111
2 SASI_Hs02_00520678 predicted 19
3 SASI_Hs02_00520679 predicted 38
4 SASI_Hs02_00520680 predicted 39
5 SASI_Hs02_00520681 predicted 38
6 SASI_Hs02_00520682 predicted 18
7 SASI_Hs02_00520683 predicted 38
8 SASI_Hs02_00520684 predicted 98
9 SASI_Hs02_00520685 predicted 86
10 SASI_Hs02_00520686 predicted 38
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520687 predicted 104
2 SASI_Hs02_00520688 predicted 16
3 SASI_Hs02_00520689 predicted 46
4 SASI_Hs02_00520690 predicted 39
5 SASI_Hs02_00520691 predicted 41
6 SASI_Hs02_00520692 predicted 24
7 SASI_Hs02_00520693 predicted 40
8 SASI_Hs02_00520694 predicted 92
9 SASI_Hs02_00520695 predicted 83
10 SASI_Hs02_00520696 predicted 40
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00520697 predicted 111
2 SASI_Hs02_00520698 predicted 23
3 SASI_Hs02_00520699 predicted 41
4 SASI_Hs02_00520700 predicted 39
5 SASI_Hs02_00520701 predicted 35
6 SASI_Hs02_00520702 predicted 21
7 SASI_Hs02_00520703 predicted 46
8 SASI_Hs02_00520704 predicted 91
9 SASI_Hs02_00520705 predicted 79
10 SASI_Hs02_00520706 predicted 34
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013697
LOC440082 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-349s1c1
Sequence:CCGGGAAAGGCTGTGAACCAGACATCTCGAGATGTCTGGTTCACAGCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013697.1-1436s1c1
Sequence:CCGGGCTGTTAATAGCTGAAGGAATCTCGAGATTCCTTCAGCTATTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-302s1c1
Sequence:CCGGGATCCTCAGCATTCTAGCATACTCGAGTATGCTAGAATGCTGAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-377s1c1
Sequence:CCGGCAAAGCACATGCTTTCCAGAACTCGAGTTCTGGAAAGCATGTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-376s1c1
Sequence:CCGGCCAAAGCACATGCTTTCCAGACTCGAGTCTGGAAAGCATGTGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-382s1c1
Sequence:CCGGCACATGCTTTCCAGAACCAGACTCGAGTCTGGTTCTGGAAAGCATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013697
LOC440082 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-349s1c1
Sequence:CCGGGAAAGGCTGTGAACCAGACATCTCGAGATGTCTGGTTCACAGCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013697.1-1436s1c1
Sequence:CCGGGCTGTTAATAGCTGAAGGAATCTCGAGATTCCTTCAGCTATTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-302s1c1
Sequence:CCGGGATCCTCAGCATTCTAGCATACTCGAGTATGCTAGAATGCTGAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-377s1c1
Sequence:CCGGCAAAGCACATGCTTTCCAGAACTCGAGTTCTGGAAAGCATGTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-376s1c1
Sequence:CCGGCCAAAGCACATGCTTTCCAGACTCGAGTCTGGAAAGCATGTGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-382s1c1
Sequence:CCGGCACATGCTTTCCAGAACCAGACTCGAGTCTGGTTCTGGAAAGCATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013697
LOC440082 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-349s1c1
Sequence:CCGGGAAAGGCTGTGAACCAGACATCTCGAGATGTCTGGTTCACAGCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013697.1-1436s1c1
Sequence:CCGGGCTGTTAATAGCTGAAGGAATCTCGAGATTCCTTCAGCTATTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-302s1c1
Sequence:CCGGGATCCTCAGCATTCTAGCATACTCGAGTATGCTAGAATGCTGAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-377s1c1
Sequence:CCGGCAAAGCACATGCTTTCCAGAACTCGAGTTCTGGAAAGCATGTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-376s1c1
Sequence:CCGGCCAAAGCACATGCTTTCCAGACTCGAGTCTGGAAAGCATGTGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013697.1-382s1c1
Sequence:CCGGCACATGCTTTCCAGAACCAGACTCGAGTCTGGTTCTGGAAAGCATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)