EMAIL THIS PAGE TO A FRIEND

LOC440157

15 Gene Product Result for
Species: Human LOC440157(440157)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013701 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013701 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081649 predicted 585
2 SASI_Hs01_00081650 predicted 1455
3 SASI_Hs01_00081651 predicted 2063
4 SASI_Hs01_00081652 predicted 1810
5 SASI_Hs01_00081653 predicted 2198
6 SASI_Hs01_00081654 predicted 1985
7 SASI_Hs01_00081655 predicted 2054
8 SASI_Hs01_00081656 predicted 1759
9 SASI_Hs01_00081657 predicted 1733
10 SASI_Hs01_00081658 predicted 2291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013701
LOC440157 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164152    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2005s1c1
Sequence:CCGGCAGATCGTGTGGTTGTTTCTTCTCGAGAAGAAACAACCACACGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-1772s1c1
Sequence:CCGGGTCCGTGATGATTTCGTTATTCTCGAGAATAACGAAATCATCACGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2189s1c1
Sequence:CCGGGAACTCTCAATGCCAGCTGTTCTCGAGAACAGCTGGCATTGAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-1781s1c1
Sequence:CCGGGATTTCGTTATTGGCAGGGAACTCGAGTTCCCTGCCAATAACGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2583s1c1
Sequence:CCGGCCCAAATGCTGTGTCCTTTAACTCGAGTTAAAGGACACAGCATTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2285s1c1
Sequence:CCGGCCACGGTCATTTCCATTGACTCTCGAGAGTCAATGGAAATGACCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013701
LOC440157 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164152    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2005s1c1
Sequence:CCGGCAGATCGTGTGGTTGTTTCTTCTCGAGAAGAAACAACCACACGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-1772s1c1
Sequence:CCGGGTCCGTGATGATTTCGTTATTCTCGAGAATAACGAAATCATCACGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2189s1c1
Sequence:CCGGGAACTCTCAATGCCAGCTGTTCTCGAGAACAGCTGGCATTGAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-1781s1c1
Sequence:CCGGGATTTCGTTATTGGCAGGGAACTCGAGTTCCCTGCCAATAACGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2583s1c1
Sequence:CCGGCCCAAATGCTGTGTCCTTTAACTCGAGTTAAAGGACACAGCATTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2285s1c1
Sequence:CCGGCCACGGTCATTTCCATTGACTCTCGAGAGTCAATGGAAATGACCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013701
LOC440157 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164152    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2005s1c1
Sequence:CCGGCAGATCGTGTGGTTGTTTCTTCTCGAGAAGAAACAACCACACGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161955    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-1772s1c1
Sequence:CCGGGTCCGTGATGATTTCGTTATTCTCGAGAATAACGAAATCATCACGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2189s1c1
Sequence:CCGGGAACTCTCAATGCCAGCTGTTCTCGAGAACAGCTGGCATTGAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187437    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-1781s1c1
Sequence:CCGGGATTTCGTTATTGGCAGGGAACTCGAGTTCCCTGCCAATAACGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2583s1c1
Sequence:CCGGCCCAAATGCTGTGTCCTTTAACTCGAGTTAAAGGACACAGCATTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188422    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013701.1-2285s1c1
Sequence:CCGGCCACGGTCATTTCCATTGACTCTCGAGAGTCAATGGAAATGACCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)