EMAIL THIS PAGE TO A FRIEND

LOC440313

40 Gene Product Result for
Species: Human LOC440313(440313)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013704 Rosetta Predictions human pricing
XR_041904 Rosetta Predictions human pricing
XR_041905 Rosetta Predictions human pricing
XR_041906 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013211 predicted 2000
2 SASI_Hs01_00013212 predicted 1996
3 SASI_Hs01_00013213 predicted 1863
4 SASI_Hs01_00013214 predicted 1793
5 SASI_Hs01_00013215 predicted 2006
6 SASI_Hs01_00013216 predicted 1895
7 SASI_Hs01_00013217 predicted 1912
8 SASI_Hs01_00013218 predicted 1798
9 SASI_Hs01_00013219 predicted 1905
10 SASI_Hs01_00013220 predicted 2000
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531372 predicted 288
2 SASI_Hs02_00531373 predicted 288
3 SASI_Hs02_00531374 predicted 222
4 SASI_Hs02_00531375 predicted 294
5 SASI_Hs02_00531376 predicted 234
6 SASI_Hs02_00531377 predicted 196
7 SASI_Hs02_00531378 predicted 374
8 SASI_Hs02_00531379 predicted 82
9 SASI_Hs02_00531380 predicted 393
10 SASI_Hs02_00531381 predicted 80
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531382 predicted 293
2 SASI_Hs02_00531383 predicted 289
3 SASI_Hs02_00531384 predicted 223
4 SASI_Hs02_00531385 predicted 291
5 SASI_Hs02_00531386 predicted 229
6 SASI_Hs02_00531387 predicted 195
7 SASI_Hs02_00531388 predicted 378
8 SASI_Hs02_00531389 predicted 85
9 SASI_Hs02_00531390 predicted 393
10 SASI_Hs02_00531391 predicted 80
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531392 predicted 289
2 SASI_Hs02_00531393 predicted 219
3 SASI_Hs02_00531394 predicted 295
4 SASI_Hs02_00531395 predicted 289
5 SASI_Hs02_00531396 predicted 233
6 SASI_Hs02_00531397 predicted 229
7 SASI_Hs02_00531398 predicted 195
8 SASI_Hs02_00531399 predicted 225
9 SASI_Hs02_00531400 predicted 370
10 SASI_Hs02_00531401 predicted 85
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013704
LOC440313 MISSION shRNA Bacterial Glycerol Stock
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013704.1-2003s1c1
Sequence:CCGGCTCTTTCTGATCCTGTCGTCTCTCGAGAGACGACAGGATCAGAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2516s1c1
Sequence:CCGGGCTGTTACTTCACCTTATCTTCTCGAGAAGATAAGGTGAAGTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-3346s1c1
Sequence:CCGGCGTATGTATCCCTTTCCACATCTCGAGATGTGGAAAGGGATACATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2804s1c1
Sequence:CCGGCGCTTTGACATAAGGATTATTCTCGAGAATAATCCTTATGTCAAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2836s1c1
Sequence:CCGGGCAACTGAGAAACAGCCAGATCTCGAGATCTGGCTGTTTCTCAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-3308s1c1
Sequence:CCGGCATAACCTTTAACAACCCTTACTCGAGTAAGGGTTGTTAAAGGTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2803s1c1
Sequence:CCGGCCGCTTTGACATAAGGATTATCTCGAGATAATCCTTATGTCAAAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2449s1c1
Sequence:CCGGCCCTTTCTGTAATGTAGCTTTCTCGAGAAAGCTACATTACAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013704
LOC440313 MISSION shRNA shRNA Plasmid DNA
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013704.1-2003s1c1
Sequence:CCGGCTCTTTCTGATCCTGTCGTCTCTCGAGAGACGACAGGATCAGAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2516s1c1
Sequence:CCGGGCTGTTACTTCACCTTATCTTCTCGAGAAGATAAGGTGAAGTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-3346s1c1
Sequence:CCGGCGTATGTATCCCTTTCCACATCTCGAGATGTGGAAAGGGATACATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2804s1c1
Sequence:CCGGCGCTTTGACATAAGGATTATTCTCGAGAATAATCCTTATGTCAAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2836s1c1
Sequence:CCGGGCAACTGAGAAACAGCCAGATCTCGAGATCTGGCTGTTTCTCAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-3308s1c1
Sequence:CCGGCATAACCTTTAACAACCCTTACTCGAGTAAGGGTTGTTAAAGGTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2803s1c1
Sequence:CCGGCCGCTTTGACATAAGGATTATCTCGAGATAATCCTTATGTCAAAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2449s1c1
Sequence:CCGGCCCTTTCTGTAATGTAGCTTTCTCGAGAAAGCTACATTACAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013704
LOC440313 MISSION shRNA Lentiviral Transduction Particles
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013704.1-2003s1c1
Sequence:CCGGCTCTTTCTGATCCTGTCGTCTCTCGAGAGACGACAGGATCAGAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160976    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2516s1c1
Sequence:CCGGGCTGTTACTTCACCTTATCTTCTCGAGAAGATAAGGTGAAGTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-3346s1c1
Sequence:CCGGCGTATGTATCCCTTTCCACATCTCGAGATGTGGAAAGGGATACATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2804s1c1
Sequence:CCGGCGCTTTGACATAAGGATTATTCTCGAGAATAATCCTTATGTCAAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2836s1c1
Sequence:CCGGGCAACTGAGAAACAGCCAGATCTCGAGATCTGGCTGTTTCTCAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160257    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-3308s1c1
Sequence:CCGGCATAACCTTTAACAACCCTTACTCGAGTAAGGGTTGTTAAAGGTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2803s1c1
Sequence:CCGGCCGCTTTGACATAAGGATTATCTCGAGATAATCCTTATGTCAAAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013704.1-2449s1c1
Sequence:CCGGCCCTTTCTGTAATGTAGCTTTCTCGAGAAAGCTACATTACAGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)