EMAIL THIS PAGE TO A FRIEND

LOC440337

40 Gene Product Result for
Species: Human LOC440337(440337)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013705 Rosetta Predictions human pricing
XR_041910 Rosetta Predictions human pricing
XR_041911 Rosetta Predictions human pricing
XR_041912 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157831 predicted 289
2 SASI_Hs01_00157832 predicted 244
3 SASI_Hs01_00157833 predicted 244
4 SASI_Hs01_00157834 predicted 296
5 SASI_Hs01_00157835 predicted 585
6 SASI_Hs01_00157836 predicted 218
7 SASI_Hs01_00157837 predicted 345
8 SASI_Hs01_00157838 predicted 585
9 SASI_Hs01_00157839 predicted 233
10 SASI_Hs01_00157840 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531432 predicted 508
2 SASI_Hs02_00531433 predicted 656
3 SASI_Hs02_00531434 predicted 719
4 SASI_Hs02_00531435 predicted 719
5 SASI_Hs02_00531436 predicted 381
6 SASI_Hs02_00531437 predicted 437
7 SASI_Hs02_00531438 predicted 758
8 SASI_Hs02_00531439 predicted 751
9 SASI_Hs02_00531440 predicted 659
10 SASI_Hs02_00531441 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531442 predicted 508
2 SASI_Hs02_00531443 predicted 655
3 SASI_Hs02_00531444 predicted 716
4 SASI_Hs02_00531445 predicted 720
5 SASI_Hs02_00531446 predicted 822
6 SASI_Hs02_00531447 predicted 386
7 SASI_Hs02_00531448 predicted 822
8 SASI_Hs02_00531449 predicted 759
9 SASI_Hs02_00531450 predicted 663
10 SASI_Hs02_00531451 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531452 predicted 507
2 SASI_Hs02_00531453 predicted 661
3 SASI_Hs02_00531454 predicted 716
4 SASI_Hs02_00531455 predicted 723
5 SASI_Hs02_00531456 predicted 379
6 SASI_Hs02_00531457 predicted 443
7 SASI_Hs02_00531458 predicted 766
8 SASI_Hs02_00531459 predicted 748
9 SASI_Hs02_00531460 predicted 660
10 SASI_Hs02_00531461 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013705
LOC440337 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-598s1c1
Sequence:CCGGCACAATCCTTCCCAACAGCTTCTCGAGAAGCTGTTGGGAAGGATTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-350s1c1
Sequence:CCGGCTCATTTATCAAGACCAGGCTCTCGAGAGCCTGGTCTTGATAAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-241s1c1
Sequence:CCGGCGAGGTGATCTAGTGTTCTTCCTCGAGGAAGAACACTAGATCACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-237s1c1
Sequence:CCGGCAAACGAGGTGATCTAGTGTTCTCGAGAACACTAGATCACCTCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-385s1c1
Sequence:CCGGCAGAGCTTCTGTTGTTTGGGACTCGAGTCCCAAACAACAGAAGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013705.1-1319s1c1
Sequence:CCGGCCAGCTTTCTAAACTGGGTATCTCGAGATACCCAGTTTAGAAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013705
LOC440337 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-598s1c1
Sequence:CCGGCACAATCCTTCCCAACAGCTTCTCGAGAAGCTGTTGGGAAGGATTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-350s1c1
Sequence:CCGGCTCATTTATCAAGACCAGGCTCTCGAGAGCCTGGTCTTGATAAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-241s1c1
Sequence:CCGGCGAGGTGATCTAGTGTTCTTCCTCGAGGAAGAACACTAGATCACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-237s1c1
Sequence:CCGGCAAACGAGGTGATCTAGTGTTCTCGAGAACACTAGATCACCTCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-385s1c1
Sequence:CCGGCAGAGCTTCTGTTGTTTGGGACTCGAGTCCCAAACAACAGAAGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013705.1-1319s1c1
Sequence:CCGGCCAGCTTTCTAAACTGGGTATCTCGAGATACCCAGTTTAGAAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013705
LOC440337 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-598s1c1
Sequence:CCGGCACAATCCTTCCCAACAGCTTCTCGAGAAGCTGTTGGGAAGGATTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-350s1c1
Sequence:CCGGCTCATTTATCAAGACCAGGCTCTCGAGAGCCTGGTCTTGATAAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-241s1c1
Sequence:CCGGCGAGGTGATCTAGTGTTCTTCCTCGAGGAAGAACACTAGATCACCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-237s1c1
Sequence:CCGGCAAACGAGGTGATCTAGTGTTCTCGAGAACACTAGATCACCTCGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013705.1-385s1c1
Sequence:CCGGCAGAGCTTCTGTTGTTTGGGACTCGAGTCCCAAACAACAGAAGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013705.1-1319s1c1
Sequence:CCGGCCAGCTTTCTAAACTGGGTATCTCGAGATACCCAGTTTAGAAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)