EMAIL THIS PAGE TO A FRIEND

LOC440558

10 Gene Product Result for
Species: Human LOC440558(440558)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013707 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013707 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013707 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013707 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013707 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062585 predicted 926
2 SASI_Hs01_00062586 predicted 927
3 SASI_Hs01_00062587 predicted 939
4 SASI_Hs01_00062588 predicted 905
5 SASI_Hs01_00062589 predicted 843
6 SASI_Hs01_00062590 predicted 904
7 SASI_Hs01_00062591 predicted 839
8 SASI_Hs01_00062592 predicted 755
9 SASI_Hs01_00062593 predicted 903
10 SASI_Hs01_00062594 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013707
LOC440558 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-814s1c1
Sequence:CCGGCTGAGCACAAAGTCTGCTCAACTCGAGTTGAGCAGACTTTGTGCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-666s1c1
Sequence:CCGGCCGCCTCTAATTAAGTCAGAACTCGAGTTCTGACTTAATTAGAGGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-1571s1c1
Sequence:CCGGCCAGGCACTTAATACTTACATCTCGAGATGTAAGTATTAAGTGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-919s1c1
Sequence:CCGGGCTCATCAAAGAGAGTCTTTACTCGAGTAAAGACTCTCTTTGATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013707.1-1563s1c1
Sequence:CCGGCCTTATTTCCAGGCACTTAATCTCGAGATTAAGTGCCTGGAAATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-841s1c1
Sequence:CCGGGCAAACGGACTATTTGTGAAACTCGAGTTTCACAAATAGTCCGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013707.1-1404s1c1
Sequence:CCGGGTCCTTTACAATTCACCAGTTCTCGAGAACTGGTGAATTGTAAAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013707
LOC440558 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-814s1c1
Sequence:CCGGCTGAGCACAAAGTCTGCTCAACTCGAGTTGAGCAGACTTTGTGCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-666s1c1
Sequence:CCGGCCGCCTCTAATTAAGTCAGAACTCGAGTTCTGACTTAATTAGAGGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-1571s1c1
Sequence:CCGGCCAGGCACTTAATACTTACATCTCGAGATGTAAGTATTAAGTGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-919s1c1
Sequence:CCGGGCTCATCAAAGAGAGTCTTTACTCGAGTAAAGACTCTCTTTGATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013707.1-1563s1c1
Sequence:CCGGCCTTATTTCCAGGCACTTAATCTCGAGATTAAGTGCCTGGAAATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-841s1c1
Sequence:CCGGGCAAACGGACTATTTGTGAAACTCGAGTTTCACAAATAGTCCGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013707.1-1404s1c1
Sequence:CCGGGTCCTTTACAATTCACCAGTTCTCGAGAACTGGTGAATTGTAAAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013707
LOC440558 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-814s1c1
Sequence:CCGGCTGAGCACAAAGTCTGCTCAACTCGAGTTGAGCAGACTTTGTGCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-666s1c1
Sequence:CCGGCCGCCTCTAATTAAGTCAGAACTCGAGTTCTGACTTAATTAGAGGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151527    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-1571s1c1
Sequence:CCGGCCAGGCACTTAATACTTACATCTCGAGATGTAAGTATTAAGTGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-919s1c1
Sequence:CCGGGCTCATCAAAGAGAGTCTTTACTCGAGTAAAGACTCTCTTTGATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013707.1-1563s1c1
Sequence:CCGGCCTTATTTCCAGGCACTTAATCTCGAGATTAAGTGCCTGGAAATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150597    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013707.1-841s1c1
Sequence:CCGGGCAAACGGACTATTTGTGAAACTCGAGTTTCACAAATAGTCCGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151369    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013707.1-1404s1c1
Sequence:CCGGGTCCTTTACAATTCACCAGTTCTCGAGAACTGGTGAATTGTAAAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)