EMAIL THIS PAGE TO A FRIEND

LOC440570

21 Gene Product Result for
Species: Human LOC440570(440570)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013708 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013708 Rosetta Predictions human pricing
XR_041951 Rosetta Predictions human pricing
XR_041952 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171589 predicted 1921
2 SASI_Hs01_00171590 predicted 1921
3 SASI_Hs01_00171591 predicted 1922
4 SASI_Hs01_00171592 predicted 1381
5 SASI_Hs01_00171593 predicted 1401
6 SASI_Hs01_00171594 predicted 1381
7 SASI_Hs01_00171595 predicted 1384
8 SASI_Hs01_00171596 predicted 1379
9 SASI_Hs01_00171597 predicted 1360
10 SASI_Hs01_00171598 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531751 predicted 1826
2 SASI_Hs02_00531752 predicted 1717
3 SASI_Hs02_00531753 predicted 1906
4 SASI_Hs02_00531754 predicted 809
5 SASI_Hs02_00531755 predicted 1286
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531756 predicted 100
2 SASI_Hs02_00531757 predicted 13
3 SASI_Hs02_00531758 predicted 597
4 SASI_Hs02_00531759 predicted 781
5 SASI_Hs02_00531760 predicted 796
6 SASI_Hs02_00531761 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013708
LOC440570 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1241s1c1
Sequence:CCGGCTGGGTCCTTTATGATGCAGACTCGAGTCTGCATCATAAAGGACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1206s1c1
Sequence:CCGGCGTCTTATTCCTTATGACGTTCTCGAGAACGTCATAAGGAATAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1205s1c1
Sequence:CCGGCCGTCTTATTCCTTATGACGTCTCGAGACGTCATAAGGAATAAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1164s1c1
Sequence:CCGGCTGGAAAGAGTTTCCCATCCACTCGAGTGGATGGGAAACTCTTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1033s1c1
Sequence:CCGGCAGAGGGAACTCTCGAAGTTTCTCGAGAAACTTCGAGAGTTCCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013708.1-1734s1c1
Sequence:CCGGCGCAGGAATCTTCCTTCACTACTCGAGTAGTGAAGGAAGATTCCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013708
LOC440570 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1241s1c1
Sequence:CCGGCTGGGTCCTTTATGATGCAGACTCGAGTCTGCATCATAAAGGACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1206s1c1
Sequence:CCGGCGTCTTATTCCTTATGACGTTCTCGAGAACGTCATAAGGAATAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1205s1c1
Sequence:CCGGCCGTCTTATTCCTTATGACGTCTCGAGACGTCATAAGGAATAAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1164s1c1
Sequence:CCGGCTGGAAAGAGTTTCCCATCCACTCGAGTGGATGGGAAACTCTTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1033s1c1
Sequence:CCGGCAGAGGGAACTCTCGAAGTTTCTCGAGAAACTTCGAGAGTTCCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013708.1-1734s1c1
Sequence:CCGGCGCAGGAATCTTCCTTCACTACTCGAGTAGTGAAGGAAGATTCCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013708
LOC440570 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1241s1c1
Sequence:CCGGCTGGGTCCTTTATGATGCAGACTCGAGTCTGCATCATAAAGGACCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1206s1c1
Sequence:CCGGCGTCTTATTCCTTATGACGTTCTCGAGAACGTCATAAGGAATAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1205s1c1
Sequence:CCGGCCGTCTTATTCCTTATGACGTCTCGAGACGTCATAAGGAATAAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1164s1c1
Sequence:CCGGCTGGAAAGAGTTTCCCATCCACTCGAGTGGATGGGAAACTCTTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013708.1-1033s1c1
Sequence:CCGGCAGAGGGAACTCTCGAAGTTTCTCGAGAAACTTCGAGAGTTCCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013708.1-1734s1c1
Sequence:CCGGCGCAGGAATCTTCCTTCACTACTCGAGTAGTGAAGGAAGATTCCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)