EMAIL THIS PAGE TO A FRIEND

LOC440742

40 Gene Product Result for
Species: Human LOC440742(440742)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013710 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013710 Rosetta Predictions human pricing
XR_040547 Rosetta Predictions human pricing
XR_040548 Rosetta Predictions human pricing
XR_040549 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036716 predicted 537
2 SASI_Hs01_00036717 predicted 551
3 SASI_Hs01_00036718 predicted 581
4 SASI_Hs01_00036719 predicted 592
5 SASI_Hs01_00036720 predicted 406
6 SASI_Hs01_00036721 predicted 559
7 SASI_Hs01_00036722 predicted 415
8 SASI_Hs01_00036723 predicted 442
9 SASI_Hs01_00036724 predicted 1243
10 SASI_Hs01_00036725 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519884 predicted 537
2 SASI_Hs02_00519885 predicted 547
3 SASI_Hs02_00519886 predicted 503
4 SASI_Hs02_00519887 predicted 402
5 SASI_Hs02_00519888 predicted 546
6 SASI_Hs02_00519889 predicted 410
7 SASI_Hs02_00519890 predicted 440
8 SASI_Hs02_00519891 predicted 502
9 SASI_Hs02_00519892 predicted 434
10 SASI_Hs02_00519893 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519894 predicted 534
2 SASI_Hs02_00519895 predicted 547
3 SASI_Hs02_00519896 predicted 500
4 SASI_Hs02_00519897 predicted 399
5 SASI_Hs02_00519898 predicted 544
6 SASI_Hs02_00519899 predicted 412
7 SASI_Hs02_00519900 predicted 432
8 SASI_Hs02_00519901 predicted 501
9 SASI_Hs02_00519902 predicted 433
10 SASI_Hs02_00519903 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00519904 predicted 534
2 SASI_Hs02_00519905 predicted 552
3 SASI_Hs02_00519906 predicted 503
4 SASI_Hs02_00519907 predicted 400
5 SASI_Hs02_00519908 predicted 552
6 SASI_Hs02_00519909 predicted 406
7 SASI_Hs02_00519910 predicted 440
8 SASI_Hs02_00519911 predicted 502
9 SASI_Hs02_00519912 predicted 438
10 SASI_Hs02_00519913 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013710
LOC440742 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013710.1-2432s1c1
Sequence:CCGGCCTTCCTGATAGACACTCCAACTCGAGTTGGAGTGTCTATCAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-490s1c1
Sequence:CCGGCAATGGAATGCAATGCTGCTACTCGAGTAGCAGCATTGCATTCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-627s1c1
Sequence:CCGGGTGTCCACTTTGCTCTTTGATCTCGAGATCAAAGAGCAAAGTGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-482s1c1
Sequence:CCGGCCACAGTGCAATGGAATGCAACTCGAGTTGCATTCCATTGCACTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013710.1-541s1c1
Sequence:CCGGGTAAATATTGCACGGGTCAAACTCGAGTTTGACCCGTGCAATATTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-632s1c1
Sequence:CCGGCACTTTGCTCTTTGATGCAATCTCGAGATTGCATCAAAGAGCAAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013710
LOC440742 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013710.1-2432s1c1
Sequence:CCGGCCTTCCTGATAGACACTCCAACTCGAGTTGGAGTGTCTATCAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-490s1c1
Sequence:CCGGCAATGGAATGCAATGCTGCTACTCGAGTAGCAGCATTGCATTCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-627s1c1
Sequence:CCGGGTGTCCACTTTGCTCTTTGATCTCGAGATCAAAGAGCAAAGTGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-482s1c1
Sequence:CCGGCCACAGTGCAATGGAATGCAACTCGAGTTGCATTCCATTGCACTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013710.1-541s1c1
Sequence:CCGGGTAAATATTGCACGGGTCAAACTCGAGTTTGACCCGTGCAATATTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-632s1c1
Sequence:CCGGCACTTTGCTCTTTGATGCAATCTCGAGATTGCATCAAAGAGCAAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013710
LOC440742 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137096    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013710.1-2432s1c1
Sequence:CCGGCCTTCCTGATAGACACTCCAACTCGAGTTGGAGTGTCTATCAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-490s1c1
Sequence:CCGGCAATGGAATGCAATGCTGCTACTCGAGTAGCAGCATTGCATTCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-627s1c1
Sequence:CCGGGTGTCCACTTTGCTCTTTGATCTCGAGATCAAAGAGCAAAGTGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-482s1c1
Sequence:CCGGCCACAGTGCAATGGAATGCAACTCGAGTTGCATTCCATTGCACTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013710.1-541s1c1
Sequence:CCGGGTAAATATTGCACGGGTCAAACTCGAGTTTGACCCGTGCAATATTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013710.1-632s1c1
Sequence:CCGGCACTTTGCTCTTTGATGCAATCTCGAGATTGCATCAAAGAGCAAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)