EMAIL THIS PAGE TO A FRIEND

LOC440905

26 Gene Product Result for
Species: Human LOC440905(440905)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013711 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013711 Rosetta Predictions human pricing
XM_001722749 Rosetta Predictions human pricing
XM_001723708 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114456 predicted 3036
2 SASI_Hs01_00114457 predicted 3037
3 SASI_Hs01_00114458 predicted 3131
4 SASI_Hs01_00114459 predicted 3392
5 SASI_Hs01_00114460 predicted 3277
6 SASI_Hs01_00114461 predicted 3287
7 SASI_Hs01_00114462 predicted 3430
8 SASI_Hs01_00114463 predicted 3117
9 SASI_Hs01_00114464 predicted 3238
10 SASI_Hs01_00114465 predicted 3264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722749 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00451050 predicted 1755
2 SASI_Hs02_00451051 predicted 1580
3 SASI_Hs02_00451052 predicted 1561
4 SASI_Hs02_00451053 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00457051 predicted 351
2 SASI_Hs02_00457052 predicted 338
3 SASI_Hs02_00457053 predicted 347
4 SASI_Hs02_00457054 predicted 348
5 SASI_Hs02_00457055 predicted 342
6 SASI_Hs02_00457056 predicted 335
7 SASI_Hs02_00457057 predicted 346
8 SASI_Hs02_00457058 predicted 366
9 SASI_Hs02_00457059 predicted 368
10 SASI_Hs02_00457060 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013711
LOC440905 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2831s1c1
Sequence:CCGGCCTTTGAAATTCCAATTCCATCTCGAGATGGAATTGGAATTTCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-3000s1c1
Sequence:CCGGGATACCCTCATCAACCCAATTCTCGAGAATTGGGTTGATGAGGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013711.1-3284s1c1
Sequence:CCGGGCCTAAAGCAATTCTTGTGATCTCGAGATCACAAGAATTGCTTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2827s1c1
Sequence:CCGGGCAACCTTTGAAATTCCAATTCTCGAGAATTGGAATTTCAAAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2993s1c1
Sequence:CCGGGAAGGAAGATACCCTCATCAACTCGAGTTGATGAGGGTATCTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013711.1-3207s1c1
Sequence:CCGGGCTGTGTGACATAGGACATATCTCGAGATATGTCCTATGTCACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013711
LOC440905 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2831s1c1
Sequence:CCGGCCTTTGAAATTCCAATTCCATCTCGAGATGGAATTGGAATTTCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-3000s1c1
Sequence:CCGGGATACCCTCATCAACCCAATTCTCGAGAATTGGGTTGATGAGGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013711.1-3284s1c1
Sequence:CCGGGCCTAAAGCAATTCTTGTGATCTCGAGATCACAAGAATTGCTTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2827s1c1
Sequence:CCGGGCAACCTTTGAAATTCCAATTCTCGAGAATTGGAATTTCAAAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2993s1c1
Sequence:CCGGGAAGGAAGATACCCTCATCAACTCGAGTTGATGAGGGTATCTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013711.1-3207s1c1
Sequence:CCGGGCTGTGTGACATAGGACATATCTCGAGATATGTCCTATGTCACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013711
LOC440905 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2831s1c1
Sequence:CCGGCCTTTGAAATTCCAATTCCATCTCGAGATGGAATTGGAATTTCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-3000s1c1
Sequence:CCGGGATACCCTCATCAACCCAATTCTCGAGAATTGGGTTGATGAGGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013711.1-3284s1c1
Sequence:CCGGGCCTAAAGCAATTCTTGTGATCTCGAGATCACAAGAATTGCTTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2827s1c1
Sequence:CCGGGCAACCTTTGAAATTCCAATTCTCGAGAATTGGAATTTCAAAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013711.1-2993s1c1
Sequence:CCGGGAAGGAAGATACCCTCATCAACTCGAGTTGATGAGGGTATCTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013711.1-3207s1c1
Sequence:CCGGGCTGTGTGACATAGGACATATCTCGAGATATGTCCTATGTCACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)