EMAIL THIS PAGE TO A FRIEND

LOC440925

42 Gene Product Result for
Species: Human LOC440925(440925)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013712 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013712 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013712 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013712 Rosetta Predictions human pricing
XR_041292 Rosetta Predictions human pricing
XR_041293 Rosetta Predictions human pricing
XR_041294 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238285 predicted 1348
2 SASI_Hs01_00238286 predicted 1412
3 SASI_Hs01_00238287 predicted 1198
4 SASI_Hs01_00238288 predicted 1054
5 SASI_Hs01_00238289 predicted 1389
6 SASI_Hs01_00238290 predicted 281
7 SASI_Hs01_00238291 predicted 398
8 SASI_Hs01_00238292 predicted 342
9 SASI_Hs01_00238293 predicted 925
10 SASI_Hs01_00238294 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526164 predicted 1332
2 SASI_Hs02_00526165 predicted 1072
3 SASI_Hs02_00526166 predicted 1427
4 SASI_Hs02_00526167 predicted 334
5 SASI_Hs02_00526168 predicted 1401
6 SASI_Hs02_00526169 predicted 1036
7 SASI_Hs02_00526170 predicted 1379
8 SASI_Hs02_00526171 predicted 905
9 SASI_Hs02_00526172 predicted 1041
10 SASI_Hs02_00526173 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526174 predicted 1335
2 SASI_Hs02_00526175 predicted 1073
3 SASI_Hs02_00526176 predicted 1435
4 SASI_Hs02_00526177 predicted 339
5 SASI_Hs02_00526178 predicted 1399
6 SASI_Hs02_00526179 predicted 1036
7 SASI_Hs02_00526180 predicted 1380
8 SASI_Hs02_00526181 predicted 906
9 SASI_Hs02_00526182 predicted 1036
10 SASI_Hs02_00526183 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00526184 predicted 1331
2 SASI_Hs02_00526185 predicted 1067
3 SASI_Hs02_00526186 predicted 1430
4 SASI_Hs02_00526187 predicted 338
5 SASI_Hs02_00526188 predicted 1394
6 SASI_Hs02_00526189 predicted 1038
7 SASI_Hs02_00526190 predicted 1380
8 SASI_Hs02_00526191 predicted 903
9 SASI_Hs02_00526192 predicted 1039
10 SASI_Hs02_00526193 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013712
LOC440925 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000167570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013712.1-1051s1c1
Sequence:CCGGGAATGAGAATATCGTACTCAACTCGAGTTGAGTACGATATTCTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013712.1-946s1c1
Sequence:CCGGGACTCGGAATCTGGACTGTATCTCGAGATACAGTCCAGATTCCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013712
LOC440925 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000167570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013712.1-1051s1c1
Sequence:CCGGGAATGAGAATATCGTACTCAACTCGAGTTGAGTACGATATTCTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013712.1-946s1c1
Sequence:CCGGGACTCGGAATCTGGACTGTATCTCGAGATACAGTCCAGATTCCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013712
LOC440925 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000167570    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013712.1-1051s1c1
Sequence:CCGGGAATGAGAATATCGTACTCAACTCGAGTTGAGTACGATATTCTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172775    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013712.1-946s1c1
Sequence:CCGGGACTCGGAATCTGGACTGTATCTCGAGATACAGTCCAGATTCCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)