EMAIL THIS PAGE TO A FRIEND

LOC441087

10 Gene Product Result for
Species: Human LOC441087(441087)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013716 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013716 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209656 predicted 703
2 SASI_Hs01_00209657 predicted 762
3 SASI_Hs01_00209658 predicted 684
4 SASI_Hs01_00209659 predicted 798
5 SASI_Hs01_00209660 predicted 387
6 SASI_Hs01_00209661 predicted 301
7 SASI_Hs01_00209662 predicted 750
8 SASI_Hs01_00209663 predicted 691
9 SASI_Hs01_00209664 predicted 283
10 SASI_Hs01_00209665 predicted 784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013716
LOC441087 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-325s1c1
Sequence:CCGGCTCTAATACCTCAAGGAATGTCTCGAGACATTCCTTGAGGTATTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013716.1-640s1c1
Sequence:CCGGGAAAGGGCAGAGGACTTTCTTCTCGAGAAGAAAGTCCTCTGCCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-283s1c1
Sequence:CCGGCACCTCAGATACCTACAGAGACTCGAGTCTCTGTAGGTATCTGAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-509s1c1
Sequence:CCGGGTTACTGTTGATGATGTACCTCTCGAGAGGTACATCATCAACAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-290s1c1
Sequence:CCGGGATACCTACAGAGACTCTGCTCTCGAGAGCAGAGTCTCTGTAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013716.1-916s1c1
Sequence:CCGGGATTGAGACCATCCTGGCTAACTCGAGTTAGCCAGGATGGTCTCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013716
LOC441087 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-325s1c1
Sequence:CCGGCTCTAATACCTCAAGGAATGTCTCGAGACATTCCTTGAGGTATTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013716.1-640s1c1
Sequence:CCGGGAAAGGGCAGAGGACTTTCTTCTCGAGAAGAAAGTCCTCTGCCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-283s1c1
Sequence:CCGGCACCTCAGATACCTACAGAGACTCGAGTCTCTGTAGGTATCTGAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-509s1c1
Sequence:CCGGGTTACTGTTGATGATGTACCTCTCGAGAGGTACATCATCAACAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-290s1c1
Sequence:CCGGGATACCTACAGAGACTCTGCTCTCGAGAGCAGAGTCTCTGTAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013716.1-916s1c1
Sequence:CCGGGATTGAGACCATCCTGGCTAACTCGAGTTAGCCAGGATGGTCTCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013716
LOC441087 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-325s1c1
Sequence:CCGGCTCTAATACCTCAAGGAATGTCTCGAGACATTCCTTGAGGTATTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013716.1-640s1c1
Sequence:CCGGGAAAGGGCAGAGGACTTTCTTCTCGAGAAGAAAGTCCTCTGCCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-283s1c1
Sequence:CCGGCACCTCAGATACCTACAGAGACTCGAGTCTCTGTAGGTATCTGAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-509s1c1
Sequence:CCGGGTTACTGTTGATGATGTACCTCTCGAGAGGTACATCATCAACAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013716.1-290s1c1
Sequence:CCGGGATACCTACAGAGACTCTGCTCTCGAGAGCAGAGTCTCTGTAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138140    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013716.1-916s1c1
Sequence:CCGGGATTGAGACCATCCTGGCTAACTCGAGTTAGCCAGGATGGTCTCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)