EMAIL THIS PAGE TO A FRIEND

LOC441179

30 Gene Product Result for
Species: Human LOC441179(441179)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013721 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013721 Rosetta Predictions human pricing
XR_040771 Rosetta Predictions human pricing
XR_040772 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178615 predicted 872
2 SASI_Hs01_00178616 predicted 566
3 SASI_Hs01_00178617 predicted 1391
4 SASI_Hs01_00178618 predicted 567
5 SASI_Hs01_00178619 predicted 524
6 SASI_Hs01_00178620 predicted 966
7 SASI_Hs01_00178621 predicted 681
8 SASI_Hs01_00178622 predicted 1425
9 SASI_Hs01_00178623 predicted 1415
10 SASI_Hs01_00178624 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521811 predicted 1136
2 SASI_Hs02_00521812 predicted 827
3 SASI_Hs02_00521813 predicted 829
4 SASI_Hs02_00521814 predicted 788
5 SASI_Hs02_00521815 predicted 423
6 SASI_Hs02_00521816 predicted 1228
7 SASI_Hs02_00521817 predicted 312
8 SASI_Hs02_00521818 predicted 945
9 SASI_Hs02_00521819 predicted 574
10 SASI_Hs02_00521820 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521821 predicted 1143
2 SASI_Hs02_00521822 predicted 829
3 SASI_Hs02_00521823 predicted 823
4 SASI_Hs02_00521824 predicted 783
5 SASI_Hs02_00521825 predicted 426
6 SASI_Hs02_00521826 predicted 1228
7 SASI_Hs02_00521827 predicted 304
8 SASI_Hs02_00521828 predicted 941
9 SASI_Hs02_00521829 predicted 578
10 SASI_Hs02_00521830 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013721
LOC441179 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-952s1c1
Sequence:CCGGCGTTTCTTTCTGCTACCGCTACTCGAGTAGCGGTAGCAGAAAGAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2154s1c1
Sequence:CCGGGCTACAAACAGCAAACTGTTTCTCGAGAAACAGTTTGCTGTTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2259s1c1
Sequence:CCGGCCTTAAAGTTATCTGCCTAAACTCGAGTTTAGGCAGATAACTTTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-1418s1c1
Sequence:CCGGGCCTAGCTTCTGTTTGATCATCTCGAGATGATCAAACAGAAGCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-678s1c1
Sequence:CCGGCGAATAGAACGTTGTGGAACACTCGAGTGTTCCACAACGTTCTATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2228s1c1
Sequence:CCGGGCTAACAGACATCACTCCCTACTCGAGTAGGGAGTGATGTCTGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-672s1c1
Sequence:CCGGCCCTTGCGAATAGAACGTTGTCTCGAGACAACGTTCTATTCGCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013721
LOC441179 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-952s1c1
Sequence:CCGGCGTTTCTTTCTGCTACCGCTACTCGAGTAGCGGTAGCAGAAAGAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2154s1c1
Sequence:CCGGGCTACAAACAGCAAACTGTTTCTCGAGAAACAGTTTGCTGTTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2259s1c1
Sequence:CCGGCCTTAAAGTTATCTGCCTAAACTCGAGTTTAGGCAGATAACTTTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-1418s1c1
Sequence:CCGGGCCTAGCTTCTGTTTGATCATCTCGAGATGATCAAACAGAAGCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-678s1c1
Sequence:CCGGCGAATAGAACGTTGTGGAACACTCGAGTGTTCCACAACGTTCTATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2228s1c1
Sequence:CCGGGCTAACAGACATCACTCCCTACTCGAGTAGGGAGTGATGTCTGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-672s1c1
Sequence:CCGGCCCTTGCGAATAGAACGTTGTCTCGAGACAACGTTCTATTCGCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013721
LOC441179 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-952s1c1
Sequence:CCGGCGTTTCTTTCTGCTACCGCTACTCGAGTAGCGGTAGCAGAAAGAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2154s1c1
Sequence:CCGGGCTACAAACAGCAAACTGTTTCTCGAGAAACAGTTTGCTGTTTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2259s1c1
Sequence:CCGGCCTTAAAGTTATCTGCCTAAACTCGAGTTTAGGCAGATAACTTTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163335    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-1418s1c1
Sequence:CCGGGCCTAGCTTCTGTTTGATCATCTCGAGATGATCAAACAGAAGCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-678s1c1
Sequence:CCGGCGAATAGAACGTTGTGGAACACTCGAGTGTTCCACAACGTTCTATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013721.1-2228s1c1
Sequence:CCGGGCTAACAGACATCACTCCCTACTCGAGTAGGGAGTGATGTCTGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013721.1-672s1c1
Sequence:CCGGCCCTTGCGAATAGAACGTTGTCTCGAGACAACGTTCTATTCGCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)