EMAIL THIS PAGE TO A FRIEND

LOC441233

40 Gene Product Result for
Species: Human LOC441233(441233)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_017959 Rosetta Predictions human pricing
XR_040798 Rosetta Predictions human pricing
XR_040799 Rosetta Predictions human pricing
XR_040800 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495077 predicted 227
2 SASI_Hs02_00495078 predicted 214
3 SASI_Hs02_00495079 predicted 199
4 SASI_Hs02_00495080 predicted 220
5 SASI_Hs02_00495081 predicted 215
6 SASI_Hs02_00495082 predicted 202
7 SASI_Hs02_00495083 predicted 233
8 SASI_Hs02_00495084 predicted 234
9 SASI_Hs02_00495085 predicted 201
10 SASI_Hs02_00495086 predicted 109
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522041 predicted 230
2 SASI_Hs02_00522042 predicted 217
3 SASI_Hs02_00522043 predicted 203
4 SASI_Hs02_00522044 predicted 218
5 SASI_Hs02_00522045 predicted 211
6 SASI_Hs02_00522046 predicted 208
7 SASI_Hs02_00522047 predicted 229
8 SASI_Hs02_00522048 predicted 225
9 SASI_Hs02_00522049 predicted 202
10 SASI_Hs02_00522050 predicted 103
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522051 predicted 232
2 SASI_Hs02_00522052 predicted 211
3 SASI_Hs02_00522053 predicted 199
4 SASI_Hs02_00522054 predicted 214
5 SASI_Hs02_00522055 predicted 208
6 SASI_Hs02_00522056 predicted 204
7 SASI_Hs02_00522057 predicted 226
8 SASI_Hs02_00522058 predicted 231
9 SASI_Hs02_00522059 predicted 203
10 SASI_Hs02_00522060 predicted 109
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522061 predicted 226
2 SASI_Hs02_00522062 predicted 212
3 SASI_Hs02_00522063 predicted 204
4 SASI_Hs02_00522064 predicted 215
5 SASI_Hs02_00522065 predicted 210
6 SASI_Hs02_00522066 predicted 208
7 SASI_Hs02_00522067 predicted 227
8 SASI_Hs02_00522068 predicted 225
9 SASI_Hs02_00522069 predicted 205
10 SASI_Hs02_00522070 predicted 108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013724
LOC441233 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-374s1c1
Sequence:CCGGCTTCGTCATTGCCAGAAGTTTCTCGAGAAACTTCTGGCAATGACGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-378s1c1
Sequence:CCGGGTCATTGCCAGAAGTTTGATTCTCGAGAATCAAACTTCTGGCAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013724.1-2364s1c1
Sequence:CCGGGCTGCCTTTAAACATCCTGAACTCGAGTTCAGGATGTTTAAAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-173s1c1
Sequence:CCGGCAAAGATGACAAGTCCCAGTACTCGAGTACTGGGACTTGTCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013724.1-868s1c1
Sequence:CCGGCCACTCTGACAAAGAGTTGAACTCGAGTTCAACTCTTTGTCAGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013724
LOC441233 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-374s1c1
Sequence:CCGGCTTCGTCATTGCCAGAAGTTTCTCGAGAAACTTCTGGCAATGACGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-378s1c1
Sequence:CCGGGTCATTGCCAGAAGTTTGATTCTCGAGAATCAAACTTCTGGCAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013724.1-2364s1c1
Sequence:CCGGGCTGCCTTTAAACATCCTGAACTCGAGTTCAGGATGTTTAAAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-173s1c1
Sequence:CCGGCAAAGATGACAAGTCCCAGTACTCGAGTACTGGGACTTGTCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013724.1-868s1c1
Sequence:CCGGCCACTCTGACAAAGAGTTGAACTCGAGTTCAACTCTTTGTCAGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013724
LOC441233 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-374s1c1
Sequence:CCGGCTTCGTCATTGCCAGAAGTTTCTCGAGAAACTTCTGGCAATGACGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-378s1c1
Sequence:CCGGGTCATTGCCAGAAGTTTGATTCTCGAGAATCAAACTTCTGGCAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013724.1-2364s1c1
Sequence:CCGGGCTGCCTTTAAACATCCTGAACTCGAGTTCAGGATGTTTAAAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013724.1-173s1c1
Sequence:CCGGCAAAGATGACAAGTCCCAGTACTCGAGTACTGGGACTTGTCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129197    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013724.1-868s1c1
Sequence:CCGGCCACTCTGACAAAGAGTTGAACTCGAGTTCAACTCTTTGTCAGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)