EMAIL THIS PAGE TO A FRIEND

LOC441268

40 Gene Product Result for
Species: Human LOC441268(441268)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013725 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013725 Rosetta Predictions human pricing
XR_041934 Rosetta Predictions human pricing
XR_041935 Rosetta Predictions human pricing
XR_041936 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077568 predicted 1657
2 SASI_Hs01_00077569 predicted 1106
3 SASI_Hs01_00077570 predicted 1667
4 SASI_Hs01_00077571 predicted 1107
5 SASI_Hs01_00077572 predicted 1796
6 SASI_Hs01_00077573 predicted 1489
7 SASI_Hs01_00077574 predicted 1596
8 SASI_Hs01_00077575 predicted 1577
9 SASI_Hs01_00077576 predicted 1482
10 SASI_Hs01_00077577 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531645 predicted 1652
2 SASI_Hs02_00531646 predicted 1095
3 SASI_Hs02_00531647 predicted 1661
4 SASI_Hs02_00531648 predicted 1097
5 SASI_Hs02_00531649 predicted 1634
6 SASI_Hs02_00531650 predicted 1672
7 SASI_Hs02_00531651 predicted 1787
8 SASI_Hs02_00531652 predicted 1632
9 SASI_Hs02_00531653 predicted 1596
10 SASI_Hs02_00531654 predicted 1574
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531655 predicted 1649
2 SASI_Hs02_00531656 predicted 1092
3 SASI_Hs02_00531657 predicted 1659
4 SASI_Hs02_00531658 predicted 1101
5 SASI_Hs02_00531659 predicted 1637
6 SASI_Hs02_00531660 predicted 1672
7 SASI_Hs02_00531661 predicted 1792
8 SASI_Hs02_00531662 predicted 1634
9 SASI_Hs02_00531663 predicted 1591
10 SASI_Hs02_00531664 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00531665 predicted 1655
2 SASI_Hs02_00531666 predicted 1093
3 SASI_Hs02_00531667 predicted 1659
4 SASI_Hs02_00531668 predicted 1099
5 SASI_Hs02_00531669 predicted 1635
6 SASI_Hs02_00531670 predicted 1676
7 SASI_Hs02_00531671 predicted 1785
8 SASI_Hs02_00531672 predicted 1629
9 SASI_Hs02_00531673 predicted 1594
10 SASI_Hs02_00531674 predicted 1577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013725
LOC441268 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000168848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013725.1-2091s1c1
Sequence:CCGGGCTCGTCCATAGAAAGACTTACTCGAGTAAGTCTTTCTATGGACGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013725.1-2124s1c1
Sequence:CCGGGCACATAGTGTATGGTGGATACTCGAGTATCCACCATACACTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013725
LOC441268 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000168848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013725.1-2091s1c1
Sequence:CCGGGCTCGTCCATAGAAAGACTTACTCGAGTAAGTCTTTCTATGGACGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013725.1-2124s1c1
Sequence:CCGGGCACATAGTGTATGGTGGATACTCGAGTATCCACCATACACTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013725
LOC441268 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000168848    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013725.1-2091s1c1
Sequence:CCGGGCTCGTCCATAGAAAGACTTACTCGAGTAAGTCTTTCTATGGACGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168750    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013725.1-2124s1c1
Sequence:CCGGGCACATAGTGTATGGTGGATACTCGAGTATCCACCATACACTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)