EMAIL THIS PAGE TO A FRIEND

LOC441511

1 Gene Product Result for
Species: Human LOC441511(441511)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_497141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_497141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_497141 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497141
LOC441511 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-820s1c1
Sequence:CCGGGCTGATATTACTCAAAGACAACTCGAGTTGTCTTTGAGTAATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-563s1c1
Sequence:CCGGGCATCGATAATGTTGGAGGAACTCGAGTTCCTCCAACATTATCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-523s1c1
Sequence:CCGGGTAACAGGATTGGCTTCTCTTCTCGAGAAGAGAAGCCAATCCTGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-530s1c1
Sequence:CCGGGATTGGCTTCTCTTACATCTACTCGAGTAGATGTAAGAGAAGCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-691s1c1
Sequence:CCGGGCCTTTAAACAGCAGTTTGTACTCGAGTACAAACTGCTGTTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497141
LOC441511 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-820s1c1
Sequence:CCGGGCTGATATTACTCAAAGACAACTCGAGTTGTCTTTGAGTAATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-563s1c1
Sequence:CCGGGCATCGATAATGTTGGAGGAACTCGAGTTCCTCCAACATTATCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-523s1c1
Sequence:CCGGGTAACAGGATTGGCTTCTCTTCTCGAGAAGAGAAGCCAATCCTGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-530s1c1
Sequence:CCGGGATTGGCTTCTCTTACATCTACTCGAGTAGATGTAAGAGAAGCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-691s1c1
Sequence:CCGGGCCTTTAAACAGCAGTTTGTACTCGAGTACAAACTGCTGTTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497141
LOC441511 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-820s1c1
Sequence:CCGGGCTGATATTACTCAAAGACAACTCGAGTTGTCTTTGAGTAATATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-563s1c1
Sequence:CCGGGCATCGATAATGTTGGAGGAACTCGAGTTCCTCCAACATTATCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-523s1c1
Sequence:CCGGGTAACAGGATTGGCTTCTCTTCTCGAGAAGAGAAGCCAATCCTGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-530s1c1
Sequence:CCGGGATTGGCTTCTCTTACATCTACTCGAGTAGATGTAAGAGAAGCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497141.1-691s1c1
Sequence:CCGGGCCTTTAAACAGCAGTTTGTACTCGAGTACAAACTGCTGTTTAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)