EMAIL THIS PAGE TO A FRIEND

LOC441722

25 Gene Product Result for
Species: Human LOC441722(441722)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001717807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001717807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001717807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717807 Rosetta Predictions human pricing
XM_497450 Rosetta Predictions human pricing
XM_938233 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00419635 predicted 882
2 SASI_Hs02_00419636 predicted 578
3 SASI_Hs02_00419637 predicted 617
4 SASI_Hs02_00419638 predicted 497
5 SASI_Hs02_00419639 predicted 697
6 SASI_Hs02_00419640 predicted 499
7 SASI_Hs02_00419641 predicted 1092
8 SASI_Hs02_00419642 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286582 predicted 874
2 SASI_Hs01_00286583 predicted 583
3 SASI_Hs01_00286584 predicted 617
4 SASI_Hs01_00286580 predicted 712
5 SASI_Hs01_00286585 predicted 496
6 SASI_Hs01_00286581 predicted 689
7 SASI_Hs01_00286586 predicted 492
8 SASI_Hs01_00286587 predicted 1083
9 SASI_Hs01_00286588 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483000 predicted 873
2 SASI_Hs02_00483001 predicted 582
3 SASI_Hs02_00483002 predicted 615
4 SASI_Hs02_00483003 predicted 502
5 SASI_Hs02_00483004 predicted 696
6 SASI_Hs02_00483005 predicted 497
7 SASI_Hs02_00483006 predicted 1084
8 SASI_Hs02_00483007 predicted 1094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001717807
LOC441722 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-588s21c1
Sequence:CCGGGCTCTTGGTTGCACCATAAACCTCGAGGTTTATGGTGCAACCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-535s21c1
Sequence:CCGGAGTCAACTGTTCATTTGATTTCTCGAGAAATCAAATGAACAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-771s21c1
Sequence:CCGGGGGAAGTTGAGGAGATGAATGCTCGAGCATTCATCTCCTCAACTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-624s21c1
Sequence:CCGGCCATTGCCCTCTTGAACATTTCTCGAGAAATGTTCAAGAGGGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-876s21c1
Sequence:CCGGACTTGAACAACCGTTGGTTTACTCGAGTAAACCAACGGTTGTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001717807
LOC441722 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-588s21c1
Sequence:CCGGGCTCTTGGTTGCACCATAAACCTCGAGGTTTATGGTGCAACCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-535s21c1
Sequence:CCGGAGTCAACTGTTCATTTGATTTCTCGAGAAATCAAATGAACAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-771s21c1
Sequence:CCGGGGGAAGTTGAGGAGATGAATGCTCGAGCATTCATCTCCTCAACTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-624s21c1
Sequence:CCGGCCATTGCCCTCTTGAACATTTCTCGAGAAATGTTCAAGAGGGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-876s21c1
Sequence:CCGGACTTGAACAACCGTTGGTTTACTCGAGTAAACCAACGGTTGTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001717807
LOC441722 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-588s21c1
Sequence:CCGGGCTCTTGGTTGCACCATAAACCTCGAGGTTTATGGTGCAACCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-535s21c1
Sequence:CCGGAGTCAACTGTTCATTTGATTTCTCGAGAAATCAAATGAACAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-771s21c1
Sequence:CCGGGGGAAGTTGAGGAGATGAATGCTCGAGCATTCATCTCCTCAACTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-624s21c1
Sequence:CCGGCCATTGCCCTCTTGAACATTTCTCGAGAAATGTTCAAGAGGGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717807.1-876s21c1
Sequence:CCGGACTTGAACAACCGTTGGTTTACTCGAGTAAACCAACGGTTGTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)