EMAIL THIS PAGE TO A FRIEND

LOC441956

26 Gene Product Result for
Species: Human LOC441956(441956)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101367 Anti-LOC441956 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013729 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_497774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_497774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_497774 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013729 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130676 predicted 1593
2 SASI_Hs01_00130677 predicted 1693
3 SASI_Hs01_00130678 predicted 1745
4 SASI_Hs01_00130679 predicted 1697
5 SASI_Hs01_00130680 predicted 1746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013729
LOC441956 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1530s21c1
Sequence:CCGGGTCCTGGACTGAGCTACTGAACTCGAGTTCAGTAGCTCAGTCCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1458s21c1
Sequence:CCGGGTCCTGGACTAAGGCACAGTACTCGAGTACTGTGCCTTAGTCCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1262s21c1
Sequence:CCGGCTCCCTGCGTCATGGACTAAGCTCGAGCTTAGTCCATGACGCAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013729.1-1578s21c1
Sequence:CCGGCTAAGGCACTGGAGAACTCTTCTCGAGAAGAGTTCTCCAGTGCCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1158s21c1
Sequence:CCGGGTCATGGACTATGGCACCAGACTCGAGTCTGGTGCCATAGTCCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013729
LOC441956 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1530s21c1
Sequence:CCGGGTCCTGGACTGAGCTACTGAACTCGAGTTCAGTAGCTCAGTCCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1458s21c1
Sequence:CCGGGTCCTGGACTAAGGCACAGTACTCGAGTACTGTGCCTTAGTCCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1262s21c1
Sequence:CCGGCTCCCTGCGTCATGGACTAAGCTCGAGCTTAGTCCATGACGCAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013729.1-1578s21c1
Sequence:CCGGCTAAGGCACTGGAGAACTCTTCTCGAGAAGAGTTCTCCAGTGCCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1158s21c1
Sequence:CCGGGTCATGGACTATGGCACCAGACTCGAGTCTGGTGCCATAGTCCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013729
LOC441956 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1530s21c1
Sequence:CCGGGTCCTGGACTGAGCTACTGAACTCGAGTTCAGTAGCTCAGTCCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1458s21c1
Sequence:CCGGGTCCTGGACTAAGGCACAGTACTCGAGTACTGTGCCTTAGTCCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1262s21c1
Sequence:CCGGCTCCCTGCGTCATGGACTAAGCTCGAGCTTAGTCCATGACGCAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269253    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013729.1-1578s21c1
Sequence:CCGGCTAAGGCACTGGAGAACTCTTCTCGAGAAGAGTTCTCCAGTGCCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013729.1-1158s21c1
Sequence:CCGGGTCATGGACTATGGCACCAGACTCGAGTCTGGTGCCATAGTCCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497774
LOC441956 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000189125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-578s1c1
Sequence:CCGGGCATCCGCAGGTTAACTGAAACTCGAGTTTCAGTTAACCTGCGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-345s1c1
Sequence:CCGGCAGAGTAGTGATACTCAAACTCTCGAGAGTTTGAGTATCACTACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-337s1c1
Sequence:CCGGCTAAGGCACAGAGTAGTGATACTCGAGTATCACTACTCTGTGCCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-342s1c1
Sequence:CCGGGCACAGAGTAGTGATACTCAACTCGAGTTGAGTATCACTACTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497774
LOC441956 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000189125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-578s1c1
Sequence:CCGGGCATCCGCAGGTTAACTGAAACTCGAGTTTCAGTTAACCTGCGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-345s1c1
Sequence:CCGGCAGAGTAGTGATACTCAAACTCTCGAGAGTTTGAGTATCACTACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-337s1c1
Sequence:CCGGCTAAGGCACAGAGTAGTGATACTCGAGTATCACTACTCTGTGCCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-342s1c1
Sequence:CCGGGCACAGAGTAGTGATACTCAACTCGAGTTGAGTATCACTACTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497774
LOC441956 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000189125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-578s1c1
Sequence:CCGGGCATCCGCAGGTTAACTGAAACTCGAGTTTCAGTTAACCTGCGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-345s1c1
Sequence:CCGGCAGAGTAGTGATACTCAAACTCTCGAGAGTTTGAGTATCACTACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-337s1c1
Sequence:CCGGCTAAGGCACAGAGTAGTGATACTCGAGTATCACTACTCTGTGCCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497774.1-342s1c1
Sequence:CCGGGCACAGAGTAGTGATACTCAACTCGAGTTGAGTATCACTACTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)