EMAIL THIS PAGE TO A FRIEND

LOC442075

35 Gene Product Result for
Species: Human LOC442075(442075)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_497910 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_497910 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_497910 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720051 Rosetta Predictions human pricing
XM_001720351 Rosetta Predictions human pricing
XM_001721526 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720051 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00434192 predicted 1082
2 SASI_Hs02_00434193 predicted 738
3 SASI_Hs02_00434194 predicted 1292
4 SASI_Hs02_00434195 predicted 1367
5 SASI_Hs02_00434196 predicted 1131
6 SASI_Hs02_00434197 predicted 728
7 SASI_Hs02_00434198 predicted 834
8 SASI_Hs02_00434199 predicted 1343
9 SASI_Hs02_00434200 predicted 1070
10 SASI_Hs02_00434201 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00436123 predicted 1078
2 SASI_Hs02_00436124 predicted 745
3 SASI_Hs02_00436125 predicted 1294
4 SASI_Hs02_00436126 predicted 1365
5 SASI_Hs02_00436127 predicted 1128
6 SASI_Hs02_00436128 predicted 730
7 SASI_Hs02_00436129 predicted 834
8 SASI_Hs02_00436130 predicted 1345
9 SASI_Hs02_00436131 predicted 1069
10 SASI_Hs02_00436132 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00443381 predicted 1081
2 SASI_Hs02_00443382 predicted 745
3 SASI_Hs02_00443383 predicted 1288
4 SASI_Hs02_00443384 predicted 1369
5 SASI_Hs02_00443385 predicted 1128
6 SASI_Hs02_00443386 predicted 723
7 SASI_Hs02_00443387 predicted 837
8 SASI_Hs02_00443388 predicted 1344
9 SASI_Hs02_00443389 predicted 1076
10 SASI_Hs02_00443390 predicted 1370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_497910
VALIDATED
LOC442075 MISSION shRNA Bacterial Glycerol Stock
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-2204s1c1
Sequence:CCGGGAACCATGTCTGCATGGAAAGCTCGAGCTTTCCATGCAGACATGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-396s1c1
Sequence:CCGGCGAGAACCTATCCATGGCAATCTCGAGATTGCCATGGATAGGTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-307s1c1
Sequence:CCGGGAGTTGCCTCTGACAACATATCTCGAGATATGTTGTCAGAGGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1728s1c1
Sequence:CCGGGAAACGTTTCTGCCTCAACAACTCGAGTTGTTGAGGCAGAAACGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1086s1c2
Sequence:CCGGCGGAGTAATGTTATATCACATCTCGAGATGTGATATAACATTACTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1638s1c1
Sequence:CCGGCCAGAAACATCTCTGGCTAAACTCGAGTTTAGCCAGAGATGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-144s1c1
Sequence:CCGGCGTTACGGTCTTCACGGCAAACTCGAGTTTGCCGTGAAGACCGTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-966s1c1
Sequence:CCGGCCGTACCACATTCCATGAGAACTCGAGTTCTCATGGAATGTGGTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1379s1c1
Sequence:CCGGCCAGCAGCAGTAGTTCAGAATCTCGAGATTCTGAACTACTGCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-721s1c1
Sequence:CCGGCAACAAGCCTTCCAGTATCAGCTCGAGCTGATACTGGAAGGCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-1637s1c1
Sequence:CCGGCCCAGAAACATCTCTGGCTAACTCGAGTTAGCCAGAGATGTTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-2394s1c1
Sequence:CCGGTCCCATGTTCAGCATTCAGAACTCGAGTTCTGAATGCTGAACATGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_497910.1-302s1c1
Sequence:CCGGGCCAGGAGTTGCCTCTGACAACTCGAGTTGTCAGAGGCAACTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-1086s1c1
Sequence:CCGGCGGAGTAATGTTATATCACATCTCGAGATGTGATATAACATTACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-897s1c1
Sequence:CCGGGAGAGACCTGAACCTGGAAATCTCGAGATTTCCAGGTTCAGGTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_497910
VALIDATED
LOC442075 MISSION shRNA shRNA Plasmid DNA
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-2204s1c1
Sequence:CCGGGAACCATGTCTGCATGGAAAGCTCGAGCTTTCCATGCAGACATGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-396s1c1
Sequence:CCGGCGAGAACCTATCCATGGCAATCTCGAGATTGCCATGGATAGGTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-307s1c1
Sequence:CCGGGAGTTGCCTCTGACAACATATCTCGAGATATGTTGTCAGAGGCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1728s1c1
Sequence:CCGGGAAACGTTTCTGCCTCAACAACTCGAGTTGTTGAGGCAGAAACGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1086s1c2
Sequence:CCGGCGGAGTAATGTTATATCACATCTCGAGATGTGATATAACATTACTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1638s1c1
Sequence:CCGGCCAGAAACATCTCTGGCTAAACTCGAGTTTAGCCAGAGATGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-144s1c1
Sequence:CCGGCGTTACGGTCTTCACGGCAAACTCGAGTTTGCCGTGAAGACCGTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-966s1c1
Sequence:CCGGCCGTACCACATTCCATGAGAACTCGAGTTCTCATGGAATGTGGTACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1379s1c1
Sequence:CCGGCCAGCAGCAGTAGTTCAGAATCTCGAGATTCTGAACTACTGCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-721s1c1
Sequence:CCGGCAACAAGCCTTCCAGTATCAGCTCGAGCTGATACTGGAAGGCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-1637s1c1
Sequence:CCGGCCCAGAAACATCTCTGGCTAACTCGAGTTAGCCAGAGATGTTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-2394s1c1
Sequence:CCGGTCCCATGTTCAGCATTCAGAACTCGAGTTCTGAATGCTGAACATGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_497910.1-302s1c1
Sequence:CCGGGCCAGGAGTTGCCTCTGACAACTCGAGTTGTCAGAGGCAACTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-1086s1c1
Sequence:CCGGCGGAGTAATGTTATATCACATCTCGAGATGTGATATAACATTACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-897s1c1
Sequence:CCGGGAGAGACCTGAACCTGGAAATCTCGAGATTTCCAGGTTCAGGTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_497910
VALIDATED
LOC442075 MISSION shRNA Lentiviral Transduction Particles
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-2204s1c1
Sequence:CCGGGAACCATGTCTGCATGGAAAGCTCGAGCTTTCCATGCAGACATGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-396s1c1
Sequence:CCGGCGAGAACCTATCCATGGCAATCTCGAGATTGCCATGGATAGGTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-307s1c1
Sequence:CCGGGAGTTGCCTCTGACAACATATCTCGAGATATGTTGTCAGAGGCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1728s1c1
Sequence:CCGGGAAACGTTTCTGCCTCAACAACTCGAGTTGTTGAGGCAGAAACGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1086s1c2
Sequence:CCGGCGGAGTAATGTTATATCACATCTCGAGATGTGATATAACATTACTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1638s1c1
Sequence:CCGGCCAGAAACATCTCTGGCTAAACTCGAGTTTAGCCAGAGATGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-144s1c1
Sequence:CCGGCGTTACGGTCTTCACGGCAAACTCGAGTTTGCCGTGAAGACCGTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199203    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-966s1c1
Sequence:CCGGCCGTACCACATTCCATGAGAACTCGAGTTCTCATGGAATGTGGTACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199429    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-1379s1c1
Sequence:CCGGCCAGCAGCAGTAGTTCAGAATCTCGAGATTCTGAACTACTGCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_497910.1-721s1c1
Sequence:CCGGCAACAAGCCTTCCAGTATCAGCTCGAGCTGATACTGGAAGGCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-1637s1c1
Sequence:CCGGCCCAGAAACATCTCTGGCTAACTCGAGTTAGCCAGAGATGTTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-2394s1c1
Sequence:CCGGTCCCATGTTCAGCATTCAGAACTCGAGTTCTGAATGCTGAACATGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:XM_497910.1-302s1c1
Sequence:CCGGGCCAGGAGTTGCCTCTGACAACTCGAGTTGTCAGAGGCAACTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-1086s1c1
Sequence:CCGGCGGAGTAATGTTATATCACATCTCGAGATGTGATATAACATTACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_497910.1-897s1c1
Sequence:CCGGGAGAGACCTGAACCTGGAAATCTCGAGATTTCCAGGTTCAGGTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)