EMAIL THIS PAGE TO A FRIEND

LOC442132

29 Gene Product Result for
Species: Human LOC442132(442132)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001034846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001034846 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_928489 Rosetta Predictions human pricing
XR_040018 Rosetta Predictions human pricing
XR_040019 Rosetta Predictions human pricing
XR_040020 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251472 predicted 50
2 SASI_Hs01_00251473 predicted 45
3 SASI_Hs01_00251474 predicted 52
4 SASI_Hs01_00251475 predicted 45
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040018 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515201 predicted 2577
2 SASI_Hs02_00515202 predicted 190
3 SASI_Hs02_00515203 predicted 2565
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515204 predicted 687
2 SASI_Hs02_00515205 predicted 731
3 SASI_Hs02_00515206 predicted 715
4 SASI_Hs02_00515207 predicted 316
5 SASI_Hs02_00515208 predicted 675
6 SASI_Hs02_00515209 predicted 693
7 SASI_Hs02_00515210 predicted 2405
8 SASI_Hs02_00515211 predicted 27
9 SASI_Hs02_00515212 predicted 82
10 SASI_Hs02_00515213 predicted 2388
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515214 predicted 317
2 SASI_Hs02_00515215 predicted 307
3 SASI_Hs02_00515216 predicted 322
4 SASI_Hs02_00515217 predicted 328
5 SASI_Hs02_00515218 predicted 329
6 SASI_Hs02_00515219 predicted 331
7 SASI_Hs02_00515220 predicted 264
8 SASI_Hs02_00515221 predicted 264
9 SASI_Hs02_00515222 predicted 165
10 SASI_Hs02_00515223 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034846
LOC442132 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034846.1-1604s1c1
Sequence:CCGGCTTCTACCGAGGAGACAAGAACTCGAGTTCTTGTCTCCTCGGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034846.1-1301s1c1
Sequence:CCGGGCTGAAGCAGAAGGAGCAAATCTCGAGATTTGCTCCTTCTGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1781s1c1
Sequence:CCGGGCACCTGTAATCACACCACTTCTCGAGAAGTGGTGTGATTACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034846.1-1588s1c1
Sequence:CCGGCCTCCTGCATCCTATTCTTCTCTCGAGAGAAGAATAGGATGCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034846.1-1292s1c1
Sequence:CCGGGAAGCAGATGCTGAAGCAGAACTCGAGTTCTGCTTCAGCATCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1782s1c1
Sequence:CCGGCACCTGTAATCACACCACTTTCTCGAGAAAGTGGTGTGATTACAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1696s1c1
Sequence:CCGGCTTGTGAATACAGTCTGAGAACTCGAGTTCTCAGACTGTATTCACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034846
LOC442132 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034846.1-1604s1c1
Sequence:CCGGCTTCTACCGAGGAGACAAGAACTCGAGTTCTTGTCTCCTCGGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034846.1-1301s1c1
Sequence:CCGGGCTGAAGCAGAAGGAGCAAATCTCGAGATTTGCTCCTTCTGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1781s1c1
Sequence:CCGGGCACCTGTAATCACACCACTTCTCGAGAAGTGGTGTGATTACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034846.1-1588s1c1
Sequence:CCGGCCTCCTGCATCCTATTCTTCTCTCGAGAGAAGAATAGGATGCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034846.1-1292s1c1
Sequence:CCGGGAAGCAGATGCTGAAGCAGAACTCGAGTTCTGCTTCAGCATCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1782s1c1
Sequence:CCGGCACCTGTAATCACACCACTTTCTCGAGAAAGTGGTGTGATTACAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1696s1c1
Sequence:CCGGCTTGTGAATACAGTCTGAGAACTCGAGTTCTCAGACTGTATTCACAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034846
LOC442132 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034846.1-1604s1c1
Sequence:CCGGCTTCTACCGAGGAGACAAGAACTCGAGTTCTTGTCTCCTCGGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001034846.1-1301s1c1
Sequence:CCGGGCTGAAGCAGAAGGAGCAAATCTCGAGATTTGCTCCTTCTGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1781s1c1
Sequence:CCGGGCACCTGTAATCACACCACTTCTCGAGAAGTGGTGTGATTACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034846.1-1588s1c1
Sequence:CCGGCCTCCTGCATCCTATTCTTCTCTCGAGAGAAGAATAGGATGCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001034846.1-1292s1c1
Sequence:CCGGGAAGCAGATGCTGAAGCAGAACTCGAGTTCTGCTTCAGCATCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153594    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1782s1c1
Sequence:CCGGCACCTGTAATCACACCACTTTCTCGAGAAAGTGGTGTGATTACAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001034846.1-1696s1c1
Sequence:CCGGCTTGTGAATACAGTCTGAGAACTCGAGTTCTCAGACTGTATTCACAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)