EMAIL THIS PAGE TO A FRIEND

LOC541473

26 Gene Product Result for
Species: Human LOC541473(541473)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411744 Anti-LOC541473 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1411775 Anti-LOC541473 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013748 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013748 Rosetta Predictions human pricing
NR_003602 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216027 predicted 207
2 SASI_Hs01_00216028 predicted 311
3 SASI_Hs01_00216029 predicted 294
4 SASI_Hs01_00216030 predicted 224
5 SASI_Hs01_00216031 predicted 315
6 SASI_Hs01_00216032 predicted 320
7 SASI_Hs01_00216033 predicted 313
8 SASI_Hs01_00216034 predicted 324
9 SASI_Hs01_00216035 predicted 321
10 SASI_Hs01_00216036 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003602 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379805 predicted 208
2 SASI_Hs02_00379806 predicted 302
3 SASI_Hs02_00379807 predicted 296
4 SASI_Hs02_00379808 predicted 218
5 SASI_Hs02_00379809 predicted 313
6 SASI_Hs02_00379810 predicted 317
7 SASI_Hs02_00379811 predicted 310
8 SASI_Hs02_00379812 predicted 314
9 SASI_Hs02_00379813 predicted 316
10 SASI_Hs02_00379814 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013748
LOC541473 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-358s1c1
Sequence:CCGGGACAGACCCTTCGATTCTAATCTCGAGATTAGAATCGAAGGGTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-225s1c1
Sequence:CCGGGTTAAGTCAGAGGATGCTGGACTCGAGTCCAGCATCCTCTGACTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-313s1c1
Sequence:CCGGGATGCTTCGGTGCTAGTGAAACTCGAGTTTCACTAGCACCGAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-341s1c1
Sequence:CCGGGATACCTGGAACACTTGGACACTCGAGTGTCCAAGTGTTCCAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-324s1c1
Sequence:CCGGGCTAGTGAAATACTATGGATACTCGAGTATCCATAGTATTTCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013748
LOC541473 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-358s1c1
Sequence:CCGGGACAGACCCTTCGATTCTAATCTCGAGATTAGAATCGAAGGGTCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-225s1c1
Sequence:CCGGGTTAAGTCAGAGGATGCTGGACTCGAGTCCAGCATCCTCTGACTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-313s1c1
Sequence:CCGGGATGCTTCGGTGCTAGTGAAACTCGAGTTTCACTAGCACCGAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-341s1c1
Sequence:CCGGGATACCTGGAACACTTGGACACTCGAGTGTCCAAGTGTTCCAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-324s1c1
Sequence:CCGGGCTAGTGAAATACTATGGATACTCGAGTATCCATAGTATTTCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013748
LOC541473 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-358s1c1
Sequence:CCGGGACAGACCCTTCGATTCTAATCTCGAGATTAGAATCGAAGGGTCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-225s1c1
Sequence:CCGGGTTAAGTCAGAGGATGCTGGACTCGAGTCCAGCATCCTCTGACTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-313s1c1
Sequence:CCGGGATGCTTCGGTGCTAGTGAAACTCGAGTTTCACTAGCACCGAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-341s1c1
Sequence:CCGGGATACCTGGAACACTTGGACACTCGAGTGTCCAAGTGTTCCAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013748.1-324s1c1
Sequence:CCGGGCTAGTGAAATACTATGGATACTCGAGTATCCATAGTATTTCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)