EMAIL THIS PAGE TO A FRIEND

LOC613206

10 Gene Product Result for
Species: Human LOC613206(613206)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033016 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033016 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033016 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033016 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158793 predicted 767
2 SASI_Hs01_00158794 predicted 1297
3 SASI_Hs01_00158795 predicted 1027
4 SASI_Hs01_00158796 predicted 833
5 SASI_Hs01_00158797 predicted 1273
6 SASI_Hs01_00158798 predicted 1284
7 SASI_Hs01_00158799 predicted 1304
8 SASI_Hs01_00158800 predicted 1285
9 SASI_Hs01_00158801 predicted 1238
10 SASI_Hs01_00158802 predicted 1286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033016
LOC613206 MISSION shRNA Bacterial Glycerol Stock
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000180611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033016.1-151s1c1
Sequence:CCGGGTTTATGACCCTGCCCAAGTTCTCGAGAACTTGGGCAGGGTCATAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033016.1-157s1c1
Sequence:CCGGGACCCTGCCCAAGTTACTTAACTCGAGTTAAGTAACTTGGGCAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033016
LOC613206 MISSION shRNA shRNA Plasmid DNA
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000180611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033016.1-151s1c1
Sequence:CCGGGTTTATGACCCTGCCCAAGTTCTCGAGAACTTGGGCAGGGTCATAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033016.1-157s1c1
Sequence:CCGGGACCCTGCCCAAGTTACTTAACTCGAGTTAAGTAACTTGGGCAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033016
LOC613206 MISSION shRNA Lentiviral Transduction Particles
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000180611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033016.1-151s1c1
Sequence:CCGGGTTTATGACCCTGCCCAAGTTCTCGAGAACTTGGGCAGGGTCATAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033016.1-157s1c1
Sequence:CCGGGACCCTGCCCAAGTTACTTAACTCGAGTTAAGTAACTTGGGCAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)