EMAIL THIS PAGE TO A FRIEND

LOC613266

84 Gene Product Result for
Species: Human LOC613266(613266)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033516 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033516 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241266 predicted 1187
2 SASI_Hs01_00241267 predicted 935
3 SASI_Hs01_00241268 predicted 1188
4 SASI_Hs01_00241269 predicted 959
5 SASI_Hs01_00241270 predicted 630
6 SASI_Hs01_00241271 predicted 872
7 SASI_Hs01_00241272 predicted 1029
8 SASI_Hs01_00241273 predicted 616
9 SASI_Hs01_00241274 predicted 883
10 SASI_Hs01_00241275 predicted 623
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033516
LOC613266 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033516.1-1537s1c1
Sequence:CCGGCGCTGAATCTTAATTGCAGTTCTCGAGAACTGCAATTAAGATTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-556s1c1
Sequence:CCGGCAACCTGACACCATCAGTATTCTCGAGAATACTGATGGTGTCAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-531s1c1
Sequence:CCGGCTTGGCATCTTCTTCCCTCAACTCGAGTTGAGGGAAGAAGATGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-491s1c1
Sequence:CCGGGCCCATTTCTCTCACCTTTATCTCGAGATAAAGGTGAGAGAAATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033516
LOC613266 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033516.1-1537s1c1
Sequence:CCGGCGCTGAATCTTAATTGCAGTTCTCGAGAACTGCAATTAAGATTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-556s1c1
Sequence:CCGGCAACCTGACACCATCAGTATTCTCGAGAATACTGATGGTGTCAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-531s1c1
Sequence:CCGGCTTGGCATCTTCTTCCCTCAACTCGAGTTGAGGGAAGAAGATGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-491s1c1
Sequence:CCGGGCCCATTTCTCTCACCTTTATCTCGAGATAAAGGTGAGAGAAATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033516
LOC613266 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033516.1-1537s1c1
Sequence:CCGGCGCTGAATCTTAATTGCAGTTCTCGAGAACTGCAATTAAGATTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-556s1c1
Sequence:CCGGCAACCTGACACCATCAGTATTCTCGAGAATACTGATGGTGTCAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-531s1c1
Sequence:CCGGCTTGGCATCTTCTTCCCTCAACTCGAGTTGAGGGAAGAAGATGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179220    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033516.1-491s1c1
Sequence:CCGGGCCCATTTCTCTCACCTTTATCTCGAGATAAAGGTGAGAGAAATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)