EMAIL THIS PAGE TO A FRIEND

LOC63930

21 Gene Product Result for
Species: Human LOC63930(63930)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022099 Rosetta Predictions human pricing
XR_039231 Rosetta Predictions human pricing
XR_039301 Rosetta Predictions human pricing
XR_040056 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240986 predicted 1315
2 SASI_Hs01_00240987 predicted 1319
3 SASI_Hs01_00240988 predicted 1256
4 SASI_Hs01_00240989 predicted 1288
5 SASI_Hs01_00240990 predicted 1226
6 SASI_Hs01_00240991 predicted 1129
7 SASI_Hs01_00240992 predicted 1358
8 SASI_Hs01_00240993 predicted 1337
9 SASI_Hs01_00240994 predicted 1362
10 SASI_Hs01_00240995 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510070 predicted 52
2 SASI_Hs02_00510071 predicted 366
3 SASI_Hs02_00510072 predicted 13
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510407 predicted 51
2 SASI_Hs02_00510408 predicted 363
3 SASI_Hs02_00510409 predicted 17
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515520 predicted 55
2 SASI_Hs02_00515521 predicted 359
3 SASI_Hs02_00515522 predicted 11
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022099
LOC63930 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000172706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-761s1c1
Sequence:CCGGGTCCCTTGTTTCCGGATTTCTCTCGAGAGAAATCCGGAAACAAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-763s1c1
Sequence:CCGGCCCTTGTTTCCGGATTTCTCTCTCGAGAGAGAAATCCGGAAACAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-775s1c1
Sequence:CCGGGATTTCTCTTCTGTGGCTTATCTCGAGATAAGCCACAGAAGAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022099
LOC63930 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000172706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-761s1c1
Sequence:CCGGGTCCCTTGTTTCCGGATTTCTCTCGAGAGAAATCCGGAAACAAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-763s1c1
Sequence:CCGGCCCTTGTTTCCGGATTTCTCTCTCGAGAGAGAAATCCGGAAACAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-775s1c1
Sequence:CCGGGATTTCTCTTCTGTGGCTTATCTCGAGATAAGCCACAGAAGAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022099
LOC63930 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000172706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-761s1c1
Sequence:CCGGGTCCCTTGTTTCCGGATTTCTCTCGAGAGAAATCCGGAAACAAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-763s1c1
Sequence:CCGGCCCTTGTTTCCGGATTTCTCTCTCGAGAGAGAAATCCGGAAACAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022099.2-775s1c1
Sequence:CCGGGATTTCTCTTCTGTGGCTTATCTCGAGATAAGCCACAGAAGAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)