EMAIL THIS PAGE TO A FRIEND

LOC642502

50 Gene Product Result for
Species: Human LOC642502(642502)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001089593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001089593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001089593 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001089593 Rosetta Predictions human pricing
XM_001717960 Rosetta Predictions human pricing
XM_001723532 Rosetta Predictions human pricing
XM_001725207 Rosetta Predictions human pricing
XM_926594 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001089593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318055 predicted 279
2 SASI_Hs02_00318056 predicted 50
3 SASI_Hs02_00318057 predicted 274
4 SASI_Hs02_00318058 predicted 15
5 SASI_Hs02_00318059 predicted 54
6 SASI_Hs02_00318060 predicted 161
7 SASI_Hs02_00318061 predicted 247
8 SASI_Hs02_00318062 predicted 221
9 SASI_Hs02_00318063 predicted 348
10 SASI_Hs02_00318064 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717960 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00420763 predicted 280
2 SASI_Hs02_00420764 predicted 673
3 SASI_Hs02_00420765 predicted 886
4 SASI_Hs02_00420766 predicted 892
5 SASI_Hs02_00420767 predicted 674
6 SASI_Hs02_00420768 predicted 502
7 SASI_Hs02_00420769 predicted 884
8 SASI_Hs02_00420770 predicted 501
9 SASI_Hs02_00420771 predicted 556
10 SASI_Hs02_00420772 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723532 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455918 predicted 502
2 SASI_Hs02_00455919 predicted 713
3 SASI_Hs02_00455920 predicted 719
4 SASI_Hs02_00455921 predicted 495
5 SASI_Hs02_00455922 predicted 338
6 SASI_Hs02_00455923 predicted 710
7 SASI_Hs02_00455924 predicted 331
8 SASI_Hs02_00455925 predicted 381
9 SASI_Hs02_00455926 predicted 565
10 SASI_Hs02_00455927 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00466263 predicted 287
2 SASI_Hs02_00466264 predicted 677
3 SASI_Hs02_00466265 predicted 893
4 SASI_Hs02_00466266 predicted 897
5 SASI_Hs02_00466267 predicted 673
6 SASI_Hs02_00466268 predicted 508
7 SASI_Hs02_00466269 predicted 877
8 SASI_Hs02_00466270 predicted 502
9 SASI_Hs02_00466271 predicted 553
10 SASI_Hs02_00466272 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271495 predicted 291
2 SASI_Hs01_00271496 predicted 674
3 SASI_Hs01_00271497 predicted 266
4 SASI_Hs01_00271498 predicted 671
5 SASI_Hs01_00271499 predicted 513
6 SASI_Hs01_00271500 predicted 879
7 SASI_Hs01_00271501 predicted 234
8 SASI_Hs01_00271502 predicted 356
9 SASI_Hs01_00271503 predicted 555
10 SASI_Hs01_00271504 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001089593
LOC642502 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000281943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-167s21c1
Sequence:CCGGTGTTACTCCCTGGGAACTTTGCTCGAGCAAAGTTCCCAGGGAGTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-35s21c1
Sequence:CCGGATTGCCTCCGAGCCCACTTTACTCGAGTAAAGTGGGCTCGGAGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-111s21c1
Sequence:CCGGCCGTGGCACTGGTATTGCTTTCTCGAGAAAGCAATACCAGTGCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-58s21c1
Sequence:CCGGCCTCAGCTCTGTATCAGAAATCTCGAGATTTCTGATACAGAGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001089593
LOC642502 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000281943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-167s21c1
Sequence:CCGGTGTTACTCCCTGGGAACTTTGCTCGAGCAAAGTTCCCAGGGAGTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-35s21c1
Sequence:CCGGATTGCCTCCGAGCCCACTTTACTCGAGTAAAGTGGGCTCGGAGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-111s21c1
Sequence:CCGGCCGTGGCACTGGTATTGCTTTCTCGAGAAAGCAATACCAGTGCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-58s21c1
Sequence:CCGGCCTCAGCTCTGTATCAGAAATCTCGAGATTTCTGATACAGAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001089593
LOC642502 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000281943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-167s21c1
Sequence:CCGGTGTTACTCCCTGGGAACTTTGCTCGAGCAAAGTTCCCAGGGAGTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-35s21c1
Sequence:CCGGATTGCCTCCGAGCCCACTTTACTCGAGTAAAGTGGGCTCGGAGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-111s21c1
Sequence:CCGGCCGTGGCACTGGTATTGCTTTCTCGAGAAAGCAATACCAGTGCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089593.1-58s21c1
Sequence:CCGGCCTCAGCTCTGTATCAGAAATCTCGAGATTTCTGATACAGAGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)