EMAIL THIS PAGE TO A FRIEND

LOC643896

7 Gene Product Result for
Species: Human LOC643896(643896)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101386 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322745 predicted 550
2 SASI_Hs02_00322746 predicted 320
3 SASI_Hs02_00322747 predicted 440
4 SASI_Hs02_00322748 predicted 479
5 SASI_Hs02_00322749 predicted 280
6 SASI_Hs02_00322750 predicted 825
7 SASI_Hs02_00322751 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101386
LOC643896 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101386.1-540s21c1
Sequence:CCGGAGAGCAACATAAGTAAGTAATCTCGAGATTACTTACTTATGTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-322s21c1
Sequence:CCGGAGCAAGCTGGCTGGTTGAAAGCTCGAGCTTTCAACCAGCCAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-294s21c1
Sequence:CCGGTCCTCAACAGAAACCATCCATCTCGAGATGGATGGTTTCTGTTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-235s21c1
Sequence:CCGGACTGCAGCTCTGGATAAGATGCTCGAGCATCTTATCCAGAGCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-67s21c1
Sequence:CCGGAGTCCAGAGAAAGTTGAAGCACTCGAGTGCTTCAACTTTCTCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101386
LOC643896 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101386.1-540s21c1
Sequence:CCGGAGAGCAACATAAGTAAGTAATCTCGAGATTACTTACTTATGTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-322s21c1
Sequence:CCGGAGCAAGCTGGCTGGTTGAAAGCTCGAGCTTTCAACCAGCCAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-294s21c1
Sequence:CCGGTCCTCAACAGAAACCATCCATCTCGAGATGGATGGTTTCTGTTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-235s21c1
Sequence:CCGGACTGCAGCTCTGGATAAGATGCTCGAGCATCTTATCCAGAGCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-67s21c1
Sequence:CCGGAGTCCAGAGAAAGTTGAAGCACTCGAGTGCTTCAACTTTCTCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101386
LOC643896 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262879    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101386.1-540s21c1
Sequence:CCGGAGAGCAACATAAGTAAGTAATCTCGAGATTACTTACTTATGTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-322s21c1
Sequence:CCGGAGCAAGCTGGCTGGTTGAAAGCTCGAGCTTTCAACCAGCCAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-294s21c1
Sequence:CCGGTCCTCAACAGAAACCATCCATCTCGAGATGGATGGTTTCTGTTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-235s21c1
Sequence:CCGGACTGCAGCTCTGGATAAGATGCTCGAGCATCTTATCCAGAGCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101386.1-67s21c1
Sequence:CCGGAGTCCAGAGAAAGTTGAAGCACTCGAGTGCTTCAACTTTCTCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)