EMAIL THIS PAGE TO A FRIEND

LOC643923

24 Gene Product Result for
Species: Human LOC643923(643923)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039772 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039772 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076449 predicted 677
2 SASI_Hs01_00076450 predicted 303
3 SASI_Hs01_00076451 predicted 207
4 SASI_Hs01_00076452 predicted 217
5 SASI_Hs01_00076453 predicted 566
6 SASI_Hs01_00076454 predicted 662
7 SASI_Hs01_00076455 predicted 483
8 SASI_Hs01_00076456 predicted 557
9 SASI_Hs01_00076457 predicted 685
10 SASI_Hs01_00076458 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039772
LOC643923 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-215s21c1
Sequence:CCGGGAAACTCCGCACTTCAATATTCTCGAGAATATTGAAGTGCGGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-313s21c1
Sequence:CCGGGTCATTTGGAGAGACCAATTTCTCGAGAAATTGGTCTCTCCAAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039772.1-687s21c1
Sequence:CCGGATCTTCGTAAAGACCTATAAGCTCGAGCTTATAGGTCTTTACGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-286s21c1
Sequence:CCGGCGTAGATTGGTACTATCAATTCTCGAGAATTGATAGTACCAATCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-391s21c1
Sequence:CCGGGGCTTGACAACCGTCCTTAACCTCGAGGTTAAGGACGGTTGTCAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039772
LOC643923 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-215s21c1
Sequence:CCGGGAAACTCCGCACTTCAATATTCTCGAGAATATTGAAGTGCGGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-313s21c1
Sequence:CCGGGTCATTTGGAGAGACCAATTTCTCGAGAAATTGGTCTCTCCAAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039772.1-687s21c1
Sequence:CCGGATCTTCGTAAAGACCTATAAGCTCGAGCTTATAGGTCTTTACGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-286s21c1
Sequence:CCGGCGTAGATTGGTACTATCAATTCTCGAGAATTGATAGTACCAATCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-391s21c1
Sequence:CCGGGGCTTGACAACCGTCCTTAACCTCGAGGTTAAGGACGGTTGTCAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039772
LOC643923 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-215s21c1
Sequence:CCGGGAAACTCCGCACTTCAATATTCTCGAGAATATTGAAGTGCGGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-313s21c1
Sequence:CCGGGTCATTTGGAGAGACCAATTTCTCGAGAAATTGGTCTCTCCAAATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039772.1-687s21c1
Sequence:CCGGATCTTCGTAAAGACCTATAAGCTCGAGCTTATAGGTCTTTACGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-286s21c1
Sequence:CCGGCGTAGATTGGTACTATCAATTCTCGAGAATTGATAGTACCAATCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039772.1-391s21c1
Sequence:CCGGGGCTTGACAACCGTCCTTAACCTCGAGGTTAAGGACGGTTGTCAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)