EMAIL THIS PAGE TO A FRIEND

LOC643997

30 Gene Product Result for
Species: Human LOC643997(643997)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_292963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292963 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001721772 Rosetta Predictions human pricing
XM_292963 Rosetta Predictions human pricing
XM_939418 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001721772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00444936 predicted 242
2 SASI_Hs02_00444937 predicted 242
3 SASI_Hs02_00444938 predicted 465
4 SASI_Hs02_00444939 predicted 39
5 SASI_Hs02_00444940 predicted 139
6 SASI_Hs02_00444941 predicted 466
7 SASI_Hs02_00444942 predicted 366
8 SASI_Hs02_00444943 predicted 104
9 SASI_Hs02_00444944 predicted 36
10 SASI_Hs02_00444945 predicted 38
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479124 predicted 245
2 SASI_Hs02_00479125 predicted 243
3 SASI_Hs02_00479126 predicted 255
4 SASI_Hs02_00479127 predicted 462
5 SASI_Hs02_00479128 predicted 36
6 SASI_Hs02_00479129 predicted 133
7 SASI_Hs02_00479130 predicted 462
8 SASI_Hs02_00479131 predicted 360
9 SASI_Hs02_00479132 predicted 107
10 SASI_Hs02_00479133 predicted 37
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483597 predicted 240
2 SASI_Hs02_00483598 predicted 243
3 SASI_Hs02_00483599 predicted 458
4 SASI_Hs02_00483600 predicted 43
5 SASI_Hs02_00483601 predicted 139
6 SASI_Hs02_00483602 predicted 463
7 SASI_Hs02_00483603 predicted 362
8 SASI_Hs02_00483604 predicted 105
9 SASI_Hs02_00483605 predicted 40
10 SASI_Hs02_00483606 predicted 38
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292963
LOC643997 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-112s1c1
Sequence:CCGGGCTCTGAATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-256s1c1
Sequence:CCGGGACAACTTCATCCTGAAGCATCTCGAGATGCTTCAGGATGAAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-72s1c1
Sequence:CCGGGTTTGCAGACAAGTTTCCAAACTCGAGTTTGGAAACTTGTCTGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-117s1c1
Sequence:CCGGGAATACTGGAGAGAAAGGATTCTCGAGAATCCTTTCTCTCCAGTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-192s1c1
Sequence:CCGGTGGTGACTTCACACACCATAACTCGAGTTATGGTGTGTGAAGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292963
LOC643997 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-112s1c1
Sequence:CCGGGCTCTGAATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-256s1c1
Sequence:CCGGGACAACTTCATCCTGAAGCATCTCGAGATGCTTCAGGATGAAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-72s1c1
Sequence:CCGGGTTTGCAGACAAGTTTCCAAACTCGAGTTTGGAAACTTGTCTGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-117s1c1
Sequence:CCGGGAATACTGGAGAGAAAGGATTCTCGAGAATCCTTTCTCTCCAGTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-192s1c1
Sequence:CCGGTGGTGACTTCACACACCATAACTCGAGTTATGGTGTGTGAAGTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292963
LOC643997 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-112s1c1
Sequence:CCGGGCTCTGAATACTGGAGAGAAACTCGAGTTTCTCTCCAGTATTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-256s1c1
Sequence:CCGGGACAACTTCATCCTGAAGCATCTCGAGATGCTTCAGGATGAAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-72s1c1
Sequence:CCGGGTTTGCAGACAAGTTTCCAAACTCGAGTTTGGAAACTTGTCTGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-117s1c1
Sequence:CCGGGAATACTGGAGAGAAAGGATTCTCGAGAATCCTTTCTCTCCAGTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292963.3-192s1c1
Sequence:CCGGTGGTGACTTCACACACCATAACTCGAGTTATGGTGTGTGAAGTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)