EMAIL THIS PAGE TO A FRIEND

LOC645139

24 Gene Product Result for
Species: Human LOC645139(645139)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001718191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001718191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001718191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718191 Rosetta Predictions human pricing
XM_928169 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00422116 predicted 662
2 SASI_Hs02_00422117 predicted 469
3 SASI_Hs02_00422118 predicted 550
4 SASI_Hs02_00422119 predicted 1451
5 SASI_Hs02_00422120 predicted 1282
6 SASI_Hs02_00422121 predicted 970
7 SASI_Hs02_00422122 predicted 1523
8 SASI_Hs02_00422123 predicted 517
9 SASI_Hs02_00422124 predicted 567
10 SASI_Hs02_00422125 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480786 predicted 583
2 SASI_Hs01_00290388 predicted 385
3 SASI_Hs01_00290389 predicted 464
4 SASI_Hs02_00480787 predicted 1368
5 SASI_Hs01_00290390 predicted 1198
6 SASI_Hs01_00290391 predicted 891
7 SASI_Hs02_00480788 predicted 1440
8 SASI_Hs01_00290392 predicted 433
9 SASI_Hs02_00480789 predicted 476
10 SASI_Hs01_00290393 predicted 684
11 SASI_Hs01_00290394 predicted 642
12 SASI_Hs01_00290395 predicted 1287
13 SASI_Hs01_00290396 predicted 397
14 SASI_Hs01_00290397 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001718191
VALIDATED
LOC645139 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-813s21c1
Sequence:CCGGGAGTGGCAACTTCCGCCAATTCTCGAGAATTGGCGGAAGTTGCCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718191.1-77s21c1
Sequence:CCGGCAGAGGACTTACTGCACAATCCTCGAGGATTGTGCAGTAAGTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-849s21c1
Sequence:CCGGTCGGACTGAATATGAAGTTAACTCGAGTTAACTTCATATTCAGTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718191.1-724s21c1
Sequence:CCGGTATCAACAGGCCACGTCTATCCTCGAGGATAGACGTGGCCTGTTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-1582s21c1
Sequence:CCGGGCAGTTTAGGTATGGTGATTTCTCGAGAAATCACCATACCTAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001718191
VALIDATED
LOC645139 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-813s21c1
Sequence:CCGGGAGTGGCAACTTCCGCCAATTCTCGAGAATTGGCGGAAGTTGCCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718191.1-77s21c1
Sequence:CCGGCAGAGGACTTACTGCACAATCCTCGAGGATTGTGCAGTAAGTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-849s21c1
Sequence:CCGGTCGGACTGAATATGAAGTTAACTCGAGTTAACTTCATATTCAGTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718191.1-724s21c1
Sequence:CCGGTATCAACAGGCCACGTCTATCCTCGAGGATAGACGTGGCCTGTTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-1582s21c1
Sequence:CCGGGCAGTTTAGGTATGGTGATTTCTCGAGAAATCACCATACCTAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001718191
VALIDATED
LOC645139 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-813s21c1
Sequence:CCGGGAGTGGCAACTTCCGCCAATTCTCGAGAATTGGCGGAAGTTGCCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718191.1-77s21c1
Sequence:CCGGCAGAGGACTTACTGCACAATCCTCGAGGATTGTGCAGTAAGTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-849s21c1
Sequence:CCGGTCGGACTGAATATGAAGTTAACTCGAGTTAACTTCATATTCAGTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718191.1-724s21c1
Sequence:CCGGTATCAACAGGCCACGTCTATCCTCGAGGATAGACGTGGCCTGTTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:XM_001718191.1-1582s21c1
Sequence:CCGGGCAGTTTAGGTATGGTGATTTCTCGAGAAATCACCATACCTAAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)