EMAIL THIS PAGE TO A FRIEND

LOC646103

3 Gene Product Result for
Species: Human LOC646103(646103)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377879 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001724296 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001724296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00460770 predicted 348
2 SASI_Hs02_00460771 predicted 333
3 SASI_Hs02_00460772 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377879
LOC646103 MISSION shRNA Bacterial Glycerol Stock
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000016708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-390s1c1
Sequence:CCGGAGCCAAGCTCTTTGTTGGAGACTCGAGTCTCCAACAAAGAGCTTGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-342s1c1
Sequence:CCGGCACTGGCAGTTCGGTGTCGGACTCGAGTCCGACACCGAACTGCCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-254s1c1
Sequence:CCGGCCATGTCTGAGGAGCAGCTGTCTCGAGACAGCTGCTCCTCAGACATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377879
LOC646103 MISSION shRNA shRNA Plasmid DNA
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000016708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-390s1c1
Sequence:CCGGAGCCAAGCTCTTTGTTGGAGACTCGAGTCTCCAACAAAGAGCTTGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-342s1c1
Sequence:CCGGCACTGGCAGTTCGGTGTCGGACTCGAGTCCGACACCGAACTGCCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-254s1c1
Sequence:CCGGCCATGTCTGAGGAGCAGCTGTCTCGAGACAGCTGCTCCTCAGACATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377879
LOC646103 MISSION shRNA Lentiviral Transduction Particles
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000016708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-390s1c1
Sequence:CCGGAGCCAAGCTCTTTGTTGGAGACTCGAGTCTCCAACAAAGAGCTTGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-342s1c1
Sequence:CCGGCACTGGCAGTTCGGTGTCGGACTCGAGTCCGACACCGAACTGCCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377879.1-254s1c1
Sequence:CCGGCCATGTCTGAGGAGCAGCTGTCTCGAGACAGCTGCTCCTCAGACATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)