EMAIL THIS PAGE TO A FRIEND

LOC646227

7 Gene Product Result for
Species: Human LOC646227(646227)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101396 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101396 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322802 predicted 233
2 SASI_Hs02_00322803 predicted 493
3 SASI_Hs02_00322804 predicted 838
4 SASI_Hs02_00322805 predicted 840
5 SASI_Hs02_00322806 predicted 477
6 SASI_Hs02_00322807 predicted 463
7 SASI_Hs02_00322808 predicted 467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101396
LOC646227 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-3648s21c1
Sequence:CCGGCTAAACCCTGTATAGTCTATGCTCGAGCATAGACTATACAGGGTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-499s21c1
Sequence:CCGGAGCTTTGCAGGTATCAGTAATCTCGAGATTACTGATACCTGCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-1123s21c1
Sequence:CCGGCTCTCACAAATGCCTATATTTCTCGAGAAATATAGGCATTTGTGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-2570s21c1
Sequence:CCGGTTGCAAGTGATTACGCTTAACCTCGAGGTTAAGCGTAATCACTTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-1001s21c1
Sequence:CCGGCGTCGAAGCTAATATTCTTATCTCGAGATAAGAATATTAGCTTCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101396
LOC646227 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-3648s21c1
Sequence:CCGGCTAAACCCTGTATAGTCTATGCTCGAGCATAGACTATACAGGGTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-499s21c1
Sequence:CCGGAGCTTTGCAGGTATCAGTAATCTCGAGATTACTGATACCTGCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-1123s21c1
Sequence:CCGGCTCTCACAAATGCCTATATTTCTCGAGAAATATAGGCATTTGTGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-2570s21c1
Sequence:CCGGTTGCAAGTGATTACGCTTAACCTCGAGGTTAAGCGTAATCACTTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-1001s21c1
Sequence:CCGGCGTCGAAGCTAATATTCTTATCTCGAGATAAGAATATTAGCTTCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101396
LOC646227 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-3648s21c1
Sequence:CCGGCTAAACCCTGTATAGTCTATGCTCGAGCATAGACTATACAGGGTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-499s21c1
Sequence:CCGGAGCTTTGCAGGTATCAGTAATCTCGAGATTACTGATACCTGCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-1123s21c1
Sequence:CCGGCTCTCACAAATGCCTATATTTCTCGAGAAATATAGGCATTTGTGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-2570s21c1
Sequence:CCGGTTGCAAGTGATTACGCTTAACCTCGAGGTTAAGCGTAATCACTTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101396.1-1001s21c1
Sequence:CCGGCGTCGAAGCTAATATTCTTATCTCGAGATAAGAATATTAGCTTCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)