EMAIL THIS PAGE TO A FRIEND

LOC646804

30 Gene Product Result for
Species: Human LOC646804(646804)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001718882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001718882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001718882 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718882 Rosetta Predictions human pricing
XM_929761 Rosetta Predictions human pricing
XM_939502 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426890 predicted 346
2 SASI_Hs02_00426891 predicted 400
3 SASI_Hs02_00426892 predicted 344
4 SASI_Hs02_00426893 predicted 340
5 SASI_Hs02_00426894 predicted 369
6 SASI_Hs02_00426895 predicted 373
7 SASI_Hs02_00426896 predicted 236
8 SASI_Hs02_00426897 predicted 370
9 SASI_Hs02_00426898 predicted 175
10 SASI_Hs02_00426899 predicted 36
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00481103 predicted 337
2 SASI_Hs02_00481104 predicted 403
3 SASI_Hs02_00481105 predicted 338
4 SASI_Hs02_00481106 predicted 334
5 SASI_Hs02_00481107 predicted 376
6 SASI_Hs02_00481108 predicted 376
7 SASI_Hs02_00481109 predicted 234
8 SASI_Hs02_00481110 predicted 364
9 SASI_Hs02_00481111 predicted 171
10 SASI_Hs02_00481112 predicted 36
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483669 predicted 346
2 SASI_Hs02_00483670 predicted 398
3 SASI_Hs02_00483671 predicted 345
4 SASI_Hs02_00483672 predicted 335
5 SASI_Hs02_00483673 predicted 371
6 SASI_Hs02_00483674 predicted 375
7 SASI_Hs02_00483675 predicted 230
8 SASI_Hs02_00483676 predicted 364
9 SASI_Hs02_00483677 predicted 178
10 SASI_Hs02_00483678 predicted 32
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001718882
LOC646804 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-64s21c1
Sequence:CCGGGCTGAAGAGGAGAGGCTTGTTCTCGAGAACAAGCCTCTCCTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-88s21c1
Sequence:CCGGGCCAGTGTTGGTTTAGGTAATCTCGAGATTACCTAAACCAACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-402s21c1
Sequence:CCGGTTTGGAAAGTGTTGATCAAACCTCGAGGTTTGATCAACACTTTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-349s21c1
Sequence:GTACCGGCTAGTCCTCATAGTAGTAGAACTCGAGTTCTACTACTATGAGGACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-42s21c1
Sequence:CCGGAGCTAGCAAAGTAATTCTTTCCTCGAGGAAAGAATTACTTTGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001718882
LOC646804 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-64s21c1
Sequence:CCGGGCTGAAGAGGAGAGGCTTGTTCTCGAGAACAAGCCTCTCCTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-88s21c1
Sequence:CCGGGCCAGTGTTGGTTTAGGTAATCTCGAGATTACCTAAACCAACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-402s21c1
Sequence:CCGGTTTGGAAAGTGTTGATCAAACCTCGAGGTTTGATCAACACTTTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-349s21c1
Sequence:GTACCGGCTAGTCCTCATAGTAGTAGAACTCGAGTTCTACTACTATGAGGACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-42s21c1
Sequence:CCGGAGCTAGCAAAGTAATTCTTTCCTCGAGGAAAGAATTACTTTGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001718882
LOC646804 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-64s21c1
Sequence:CCGGGCTGAAGAGGAGAGGCTTGTTCTCGAGAACAAGCCTCTCCTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-88s21c1
Sequence:CCGGGCCAGTGTTGGTTTAGGTAATCTCGAGATTACCTAAACCAACACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-402s21c1
Sequence:CCGGTTTGGAAAGTGTTGATCAAACCTCGAGGTTTGATCAACACTTTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-349s21c1
Sequence:GTACCGGCTAGTCCTCATAGTAGTAGAACTCGAGTTCTACTACTATGAGGACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001718882.1-42s21c1
Sequence:CCGGAGCTAGCAAAGTAATTCTTTCCTCGAGGAAAGAATTACTTTGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)