EMAIL THIS PAGE TO A FRIEND

LOC647208

20 Gene Product Result for
Species: Human LOC647208(647208)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496155 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_496155 Rosetta Predictions human pricing
XR_037904 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290192 predicted 696
2 SASI_Hs01_00290193 predicted 686
3 SASI_Hs01_00290194 predicted 715
4 SASI_Hs01_00290195 predicted 659
5 SASI_Hs01_00290196 predicted 666
6 SASI_Hs01_00290197 predicted 1462
7 SASI_Hs01_00290198 predicted 999
8 SASI_Hs01_00290199 predicted 938
9 SASI_Hs01_00290200 predicted 722
10 SASI_Hs01_00290201 predicted 1148
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_037904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00503868 predicted 388
2 SASI_Hs02_00503869 predicted 198
3 SASI_Hs02_00503870 predicted 435
4 SASI_Hs02_00503871 predicted 240
5 SASI_Hs02_00503872 predicted 301
6 SASI_Hs02_00503873 predicted 463
7 SASI_Hs02_00503874 predicted 194
8 SASI_Hs02_00503875 predicted 292
9 SASI_Hs02_00503876 predicted 331
10 SASI_Hs02_00503877 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496155
LOC647208 MISSION shRNA Bacterial Glycerol Stock
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2276s1c1
Sequence:CCGGGCTGGCCCAGAGGCCCTTCTTCTCGAGAAGAAGGGCCTCTGGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2319s1c1
Sequence:CCGGGCCGTGGACCTGTACGAGTATCTCGAGATACTCGTACAGGTCCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-1986s1c1
Sequence:CCGGCGTCCCGTCCTGGGTGGGTTTCTCGAGAAACCCACCCAGGACGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2134s1c1
Sequence:CCGGGCTGCGGAGCAGCCTGCATTTCTCGAGAAATGCAGGCTGCTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2112s1c1
Sequence:CCGGGACTTTCTCGTGCTGGAGGTTCTCGAGAACCTCCAGCACGAGAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2134s1c2
Sequence:CCGGGCTGCGGAGCAGCCTGCATTTCTCGAGAAATGCAGGCTGCTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496155
LOC647208 MISSION shRNA shRNA Plasmid DNA
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2276s1c1
Sequence:CCGGGCTGGCCCAGAGGCCCTTCTTCTCGAGAAGAAGGGCCTCTGGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2319s1c1
Sequence:CCGGGCCGTGGACCTGTACGAGTATCTCGAGATACTCGTACAGGTCCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-1986s1c1
Sequence:CCGGCGTCCCGTCCTGGGTGGGTTTCTCGAGAAACCCACCCAGGACGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2134s1c1
Sequence:CCGGGCTGCGGAGCAGCCTGCATTTCTCGAGAAATGCAGGCTGCTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2112s1c1
Sequence:CCGGGACTTTCTCGTGCTGGAGGTTCTCGAGAACCTCCAGCACGAGAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2134s1c2
Sequence:CCGGGCTGCGGAGCAGCCTGCATTTCTCGAGAAATGCAGGCTGCTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496155
LOC647208 MISSION shRNA Lentiviral Transduction Particles
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2276s1c1
Sequence:CCGGGCTGGCCCAGAGGCCCTTCTTCTCGAGAAGAAGGGCCTCTGGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2319s1c1
Sequence:CCGGGCCGTGGACCTGTACGAGTATCTCGAGATACTCGTACAGGTCCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-1986s1c1
Sequence:CCGGCGTCCCGTCCTGGGTGGGTTTCTCGAGAAACCCACCCAGGACGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2134s1c1
Sequence:CCGGGCTGCGGAGCAGCCTGCATTTCTCGAGAAATGCAGGCTGCTCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2112s1c1
Sequence:CCGGGACTTTCTCGTGCTGGAGGTTCTCGAGAACCTCCAGCACGAGAAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496155.1-2134s1c2
Sequence:CCGGGCTGCGGAGCAGCCTGCATTTCTCGAGAAATGCAGGCTGCTCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)