EMAIL THIS PAGE TO A FRIEND

LOC649330

4 Gene Product Result for
Species: Human LOC649330(649330)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001723218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001723218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001723218 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723218 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00454023 predicted 512
2 SASI_Hs02_00454024 predicted 937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001723218
LOC649330 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-519s21c1
Sequence:CCGGTATAACTTGCAACGGGATTATCTCGAGATAATCCCGTTGCAAGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-409s21c1
Sequence:CCGGCTAGCCAGGTTGTAGATATTACTCGAGTAATATCTACAACCTGGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001723218.1-1113s21c1
Sequence:CCGGTGCTTGTCTAACATCAAATTTCTCGAGAAATTTGATGTTAGACAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-809s21c1
Sequence:CCGGCAAGCAAGGAGTAGAGGTAAACTCGAGTTTACCTCTACTCCTTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-938s21c1
Sequence:CCGGCCTACTGTGTGATGATGATAACTCGAGTTATCATCATCACACAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001723218
LOC649330 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-519s21c1
Sequence:CCGGTATAACTTGCAACGGGATTATCTCGAGATAATCCCGTTGCAAGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-409s21c1
Sequence:CCGGCTAGCCAGGTTGTAGATATTACTCGAGTAATATCTACAACCTGGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001723218.1-1113s21c1
Sequence:CCGGTGCTTGTCTAACATCAAATTTCTCGAGAAATTTGATGTTAGACAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-809s21c1
Sequence:CCGGCAAGCAAGGAGTAGAGGTAAACTCGAGTTTACCTCTACTCCTTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-938s21c1
Sequence:CCGGCCTACTGTGTGATGATGATAACTCGAGTTATCATCATCACACAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001723218
LOC649330 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-519s21c1
Sequence:CCGGTATAACTTGCAACGGGATTATCTCGAGATAATCCCGTTGCAAGTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-409s21c1
Sequence:CCGGCTAGCCAGGTTGTAGATATTACTCGAGTAATATCTACAACCTGGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240090    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001723218.1-1113s21c1
Sequence:CCGGTGCTTGTCTAACATCAAATTTCTCGAGAAATTTGATGTTAGACAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-809s21c1
Sequence:CCGGCAAGCAAGGAGTAGAGGTAAACTCGAGTTTACCTCTACTCCTTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723218.1-938s21c1
Sequence:CCGGCCTACTGTGTGATGATGATAACTCGAGTTATCATCATCACACAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)