EMAIL THIS PAGE TO A FRIEND

LOC650293

17 Gene Product Result for
Species: Human LOC650293(650293)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040071 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040071 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308802 predicted 284
2 SASI_Hs01_00143556 predicted 266
3 SASI_Hs01_00143558 predicted 290
4 SASI_Hs02_00308803 predicted 400
5 SASI_Hs01_00143555 predicted 385
6 SASI_Hs02_00308804 predicted 375
7 SASI_Hs01_00143557 predicted 388
8 SASI_Hs01_00143559 predicted 389
9 SASI_Hs01_00143560 predicted 488
10 SASI_Hs01_00143561 predicted 524
11 SASI_Hs01_00143562 predicted 508
12 SASI_Hs01_00143563 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040071
LOC650293 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-410s21c1
Sequence:CCGGAGAATGTGGAAATCTCTAATTCTCGAGAATTAGAGATTTCCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-317s21c1
Sequence:CCGGACCTCTGTGTCTTCTTCATTTCTCGAGAAATGAAGAAGACACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-293s21c1
Sequence:CCGGATTACCCAGTCATCGTGAATCCTCGAGGATTCACGATGACTGGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-378s21c1
Sequence:CCGGCAGTTGGATTGTGTTACAATTCTCGAGAATTGTAACACAATCCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-475s21c1
Sequence:CCGGAGCGTCATCAATAGCATATTCCTCGAGGAATATGCTATTGATGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040071
LOC650293 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-410s21c1
Sequence:CCGGAGAATGTGGAAATCTCTAATTCTCGAGAATTAGAGATTTCCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-317s21c1
Sequence:CCGGACCTCTGTGTCTTCTTCATTTCTCGAGAAATGAAGAAGACACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-293s21c1
Sequence:CCGGATTACCCAGTCATCGTGAATCCTCGAGGATTCACGATGACTGGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-378s21c1
Sequence:CCGGCAGTTGGATTGTGTTACAATTCTCGAGAATTGTAACACAATCCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-475s21c1
Sequence:CCGGAGCGTCATCAATAGCATATTCCTCGAGGAATATGCTATTGATGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040071
LOC650293 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-410s21c1
Sequence:CCGGAGAATGTGGAAATCTCTAATTCTCGAGAATTAGAGATTTCCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-317s21c1
Sequence:CCGGACCTCTGTGTCTTCTTCATTTCTCGAGAAATGAAGAAGACACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-293s21c1
Sequence:CCGGATTACCCAGTCATCGTGAATCCTCGAGGATTCACGATGACTGGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-378s21c1
Sequence:CCGGCAGTTGGATTGTGTTACAATTCTCGAGAATTGTAACACAATCCAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040071.1-475s21c1
Sequence:CCGGAGCGTCATCAATAGCATATTCCTCGAGGAATATGCTATTGATGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)