EMAIL THIS PAGE TO A FRIEND

LOC653486

22 Gene Product Result for
Species: Human LOC653486(653486)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001097610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001097610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001097610 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001097610 Rosetta Predictions human pricing
XM_001723174 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318400 predicted 225
2 SASI_Hs02_00318401 predicted 220
3 SASI_Hs02_00318402 predicted 280
4 SASI_Hs02_00318403 predicted 325
5 SASI_Hs02_00318404 predicted 104
6 SASI_Hs02_00318405 predicted 168
7 SASI_Hs02_00318406 predicted 293
8 SASI_Hs02_00318407 predicted 155
9 SASI_Hs02_00318408 predicted 266
10 SASI_Hs02_00318409 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00453705 predicted 218
2 SASI_Hs02_00453706 predicted 357
3 SASI_Hs02_00453707 predicted 370
4 SASI_Hs02_00453708 predicted 219
5 SASI_Hs02_00453709 predicted 277
6 SASI_Hs02_00453710 predicted 387
7 SASI_Hs02_00453711 predicted 394
8 SASI_Hs02_00453712 predicted 317
9 SASI_Hs02_00453713 predicted 101
10 SASI_Hs02_00453714 predicted 158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001097610
LOC653486 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-188s21c1
Sequence:CCGGCGAAGATGCCAAGGCAGCAATCTCGAGATTGCTGCCTTGGCATCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-107s21c1
Sequence:CCGGTTTCATGGACTTCCTGCAAACCTCGAGGTTTGCAGGAAGTCCATGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-52s21c1
Sequence:CCGGCCCTCACCCTGTTCTGCATCTCTCGAGAGATGCAGAACAGGGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-165s21c1
Sequence:CCGGACCTTGGGCAAGTACAATGTCCTCGAGGACATTGTACTTGCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-176s21c1
Sequence:CCGGGTACAATGTCAACGAAGATGCCTCGAGGCATCTTCGTTGACATTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001097610
LOC653486 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-188s21c1
Sequence:CCGGCGAAGATGCCAAGGCAGCAATCTCGAGATTGCTGCCTTGGCATCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-107s21c1
Sequence:CCGGTTTCATGGACTTCCTGCAAACCTCGAGGTTTGCAGGAAGTCCATGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-52s21c1
Sequence:CCGGCCCTCACCCTGTTCTGCATCTCTCGAGAGATGCAGAACAGGGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-165s21c1
Sequence:CCGGACCTTGGGCAAGTACAATGTCCTCGAGGACATTGTACTTGCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-176s21c1
Sequence:CCGGGTACAATGTCAACGAAGATGCCTCGAGGCATCTTCGTTGACATTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001097610
LOC653486 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-188s21c1
Sequence:CCGGCGAAGATGCCAAGGCAGCAATCTCGAGATTGCTGCCTTGGCATCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-107s21c1
Sequence:CCGGTTTCATGGACTTCCTGCAAACCTCGAGGTTTGCAGGAAGTCCATGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-52s21c1
Sequence:CCGGCCCTCACCCTGTTCTGCATCTCTCGAGAGATGCAGAACAGGGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-165s21c1
Sequence:CCGGACCTTGGGCAAGTACAATGTCCTCGAGGACATTGTACTTGCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001097610.2-176s21c1
Sequence:CCGGGTACAATGTCAACGAAGATGCCTCGAGGCATCTTCGTTGACATTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)