EMAIL THIS PAGE TO A FRIEND

LOC653650

61 Gene Product Result for
Species: Human LOC653650(653650)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402098 Monoclonal Anti-PDPK2 antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_496112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_496112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_496112 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_496112 Rosetta Predictions human pricing
XM_935344 Rosetta Predictions human pricing
XM_935346 Rosetta Predictions human pricing
XM_935348 Rosetta Predictions human pricing
XM_935349 Rosetta Predictions human pricing
XM_935350 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289852 predicted 1566
2 SASI_Hs01_00289853 predicted 1799
3 SASI_Hs01_00289854 predicted 1653
4 SASI_Hs01_00289855 predicted 1260
5 SASI_Hs01_00289856 predicted 1723
6 SASI_Hs01_00289857 predicted 1688
7 SASI_Hs01_00289858 predicted 2007
8 SASI_Hs01_00289859 predicted 1397
9 SASI_Hs01_00289860 predicted 1288
10 SASI_Hs01_00289861 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295288 predicted 666
2 SASI_Hs01_00295289 predicted 627
3 SASI_Hs01_00295290 predicted 435
4 SASI_Hs01_00295291 predicted 458
5 SASI_Hs01_00295292 predicted 499
6 SASI_Hs01_00295293 predicted 733
7 SASI_Hs01_00295294 predicted 433
8 SASI_Hs01_00295295 predicted 577
9 SASI_Hs01_00295296 predicted 463
10 SASI_Hs01_00295297 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301083 predicted 620
2 SASI_Hs01_00301084 predicted 435
3 SASI_Hs01_00301085 predicted 459
4 SASI_Hs01_00301086 predicted 503
5 SASI_Hs01_00301087 predicted 769
6 SASI_Hs01_00301088 predicted 437
7 SASI_Hs01_00301089 predicted 575
8 SASI_Hs01_00301090 predicted 468
9 SASI_Hs01_00301091 predicted 468
10 SASI_Hs01_00301092 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296000 predicted 1500
2 SASI_Hs01_00296001 predicted 1453
3 SASI_Hs01_00296002 predicted 1259
4 SASI_Hs01_00296003 predicted 1294
5 SASI_Hs01_00296004 predicted 1043
6 SASI_Hs01_00296005 predicted 1328
7 SASI_Hs01_00296006 predicted 1264
8 SASI_Hs01_00296007 predicted 1398
9 SASI_Hs01_00296008 predicted 1291
10 SASI_Hs01_00296009 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254507 predicted 1586
2 SASI_Hs01_00254508 predicted 1451
3 SASI_Hs01_00254509 predicted 1262
4 SASI_Hs01_00254510 predicted 1288
5 SASI_Hs01_00254511 predicted 1040
6 SASI_Hs01_00254512 predicted 1326
7 SASI_Hs01_00254513 predicted 1260
8 SASI_Hs01_00254514 predicted 1399
9 SASI_Hs01_00254515 predicted 1295
10 SASI_Hs01_00254516 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250530 predicted 1223
2 SASI_Hs01_00250531 predicted 1460
3 SASI_Hs01_00250532 predicted 1313
4 SASI_Hs01_00250533 predicted 919
5 SASI_Hs01_00250534 predicted 1389
6 SASI_Hs01_00250535 predicted 1346
7 SASI_Hs01_00250536 predicted 1059
8 SASI_Hs01_00250537 predicted 959
9 SASI_Hs01_00250538 predicted 962
10 SASI_Hs01_00250539 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496112
LOC653650 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1967s1c1
Sequence:CCGGCTCCGTGCACTGGGCTTCATGCTCGAGCATGAAGCCCAGTGCACGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1257s1c1
Sequence:CCGGGAAGCTGTATTTCGGCCTTAGCTCGAGCTAAGGCCGAAATACAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1672s1c1
Sequence:CCGGCAGAAGATCATTAAGTTGGAACTCGAGTTCCAACTTAATGATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496112.2-2242s1c1
Sequence:CCGGGCCTGTCGCATCTGCGCTTGGCTCGAGCCAAGCGCAGATGCGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496112.2-2139s1c1
Sequence:CCGGGTGGACAGGCTAGTGAGTTTCCTCGAGGAAACTCACTAGCCTGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496112
LOC653650 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1967s1c1
Sequence:CCGGCTCCGTGCACTGGGCTTCATGCTCGAGCATGAAGCCCAGTGCACGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1257s1c1
Sequence:CCGGGAAGCTGTATTTCGGCCTTAGCTCGAGCTAAGGCCGAAATACAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1672s1c1
Sequence:CCGGCAGAAGATCATTAAGTTGGAACTCGAGTTCCAACTTAATGATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496112.2-2242s1c1
Sequence:CCGGGCCTGTCGCATCTGCGCTTGGCTCGAGCCAAGCGCAGATGCGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496112.2-2139s1c1
Sequence:CCGGGTGGACAGGCTAGTGAGTTTCCTCGAGGAAACTCACTAGCCTGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496112
LOC653650 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1967s1c1
Sequence:CCGGCTCCGTGCACTGGGCTTCATGCTCGAGCATGAAGCCCAGTGCACGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1257s1c1
Sequence:CCGGGAAGCTGTATTTCGGCCTTAGCTCGAGCTAAGGCCGAAATACAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496112.2-1672s1c1
Sequence:CCGGCAGAAGATCATTAAGTTGGAACTCGAGTTCCAACTTAATGATCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496112.2-2242s1c1
Sequence:CCGGGCCTGTCGCATCTGCGCTTGGCTCGAGCCAAGCGCAGATGCGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199646    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_496112.2-2139s1c1
Sequence:CCGGGTGGACAGGCTAGTGAGTTTCCTCGAGGAAACTCACTAGCCTGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)