EMAIL THIS PAGE TO A FRIEND

LOC727947

15 Gene Product Result for
Species: Human LOC727947(727947)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001126641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001126641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001126641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001126641 Rosetta Predictions human pricing
XM_001133753 Rosetta Predictions human pricing
XM_001722943 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001126641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00383043 predicted 189
2 SASI_Hs02_00383044 predicted 101
3 SASI_Hs02_00383045 predicted 12
4 SASI_Hs02_00383046 predicted 59
5 SASI_Hs02_00383047 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001133753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00391358 predicted 187
2 SASI_Hs02_00391359 predicted 96
3 SASI_Hs02_00391360 predicted 9
4 SASI_Hs02_00391361 predicted 55
5 SASI_Hs02_00391362 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722943 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452223 predicted 193
2 SASI_Hs02_00452224 predicted 98
3 SASI_Hs02_00452225 predicted 10
4 SASI_Hs02_00452226 predicted 56
5 SASI_Hs02_00452227 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001126641
LOC727947 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-206s21c1
Sequence:CCGGTGTCCATGAAGCATCAGATCTCTCGAGAGATCTGATGCTTCATGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-195s21c1
Sequence:CCGGGGCACTGGACCTGTCCATGAACTCGAGTTCATGGACAGGTCCAGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-65s21c1
Sequence:CCGGACAACGCCACAGGATTCAATACTCGAGTATTGAATCCTGTGGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-170s21c1
Sequence:GTACCGGATGACAGGATGTTTCACATGACTCGAGTCATGTGAAACATCCTGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-114s21c1
Sequence:CCGGATATGAGAATGAAGATGTGAACTCGAGTTCACATCTTCATTCTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001126641
LOC727947 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-206s21c1
Sequence:CCGGTGTCCATGAAGCATCAGATCTCTCGAGAGATCTGATGCTTCATGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-195s21c1
Sequence:CCGGGGCACTGGACCTGTCCATGAACTCGAGTTCATGGACAGGTCCAGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-65s21c1
Sequence:CCGGACAACGCCACAGGATTCAATACTCGAGTATTGAATCCTGTGGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-170s21c1
Sequence:GTACCGGATGACAGGATGTTTCACATGACTCGAGTCATGTGAAACATCCTGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-114s21c1
Sequence:CCGGATATGAGAATGAAGATGTGAACTCGAGTTCACATCTTCATTCTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001126641
LOC727947 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-206s21c1
Sequence:CCGGTGTCCATGAAGCATCAGATCTCTCGAGAGATCTGATGCTTCATGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-195s21c1
Sequence:CCGGGGCACTGGACCTGTCCATGAACTCGAGTTCATGGACAGGTCCAGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-65s21c1
Sequence:CCGGACAACGCCACAGGATTCAATACTCGAGTATTGAATCCTGTGGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-170s21c1
Sequence:GTACCGGATGACAGGATGTTTCACATGACTCGAGTCATGTGAAACATCCTGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001126641.1-114s21c1
Sequence:CCGGATATGAGAATGAAGATGTGAACTCGAGTTCACATCTTCATTCTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)