EMAIL THIS PAGE TO A FRIEND

LOC728819

12 Gene Product Result for
Species: Human LOC728819(728819)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101330 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101330 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322615 predicted 587
2 SASI_Hs02_00322616 predicted 714
3 SASI_Hs02_00322617 predicted 392
4 SASI_Hs02_00322618 predicted 659
5 SASI_Hs02_00322619 predicted 580
6 SASI_Hs02_00322620 predicted 554
7 SASI_Hs02_00322621 predicted 492
8 SASI_Hs02_00322622 predicted 603
9 SASI_Hs02_00322623 predicted 352
10 SASI_Hs02_00322624 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101330
LOC728819 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101330.1-996s21c1
Sequence:CCGGGGCTAGTCCAAATTCTGATACCTCGAGGTATCAGAATTTGGACTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-606s21c1
Sequence:CCGGTGAGACCTGTGCAGATCAAAGCTCGAGCTTTGATCTGCACAGGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-582s21c1
Sequence:CCGGACTTAACAGACTTCTCGATAACTCGAGTTATCGAGAAGTCTGTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-139s21c1
Sequence:CCGGCCACCTAACAGGAACGATTTCCTCGAGGAAATCGTTCCTGTTAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-497s21c1
Sequence:CCGGATCTGGGCCACACTGTTATATCTCGAGATATAACAGTGTGGCCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101330
LOC728819 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101330.1-996s21c1
Sequence:CCGGGGCTAGTCCAAATTCTGATACCTCGAGGTATCAGAATTTGGACTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-606s21c1
Sequence:CCGGTGAGACCTGTGCAGATCAAAGCTCGAGCTTTGATCTGCACAGGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-582s21c1
Sequence:CCGGACTTAACAGACTTCTCGATAACTCGAGTTATCGAGAAGTCTGTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-139s21c1
Sequence:CCGGCCACCTAACAGGAACGATTTCCTCGAGGAAATCGTTCCTGTTAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-497s21c1
Sequence:CCGGATCTGGGCCACACTGTTATATCTCGAGATATAACAGTGTGGCCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101330
LOC728819 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101330.1-996s21c1
Sequence:CCGGGGCTAGTCCAAATTCTGATACCTCGAGGTATCAGAATTTGGACTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-606s21c1
Sequence:CCGGTGAGACCTGTGCAGATCAAAGCTCGAGCTTTGATCTGCACAGGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-582s21c1
Sequence:CCGGACTTAACAGACTTCTCGATAACTCGAGTTATCGAGAAGTCTGTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-139s21c1
Sequence:CCGGCCACCTAACAGGAACGATTTCCTCGAGGAAATCGTTCCTGTTAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101330.1-497s21c1
Sequence:CCGGATCTGGGCCACACTGTTATATCTCGAGATATAACAGTGTGGCCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)