EMAIL THIS PAGE TO A FRIEND

LOC730144

27 Gene Product Result for
Species: Human LOC730144(730144)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001131332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001131332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001131332 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001131332 Rosetta Predictions human pricing
XM_001132642 Rosetta Predictions human pricing
XM_001718580 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001131332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00388228 predicted 76
2 SASI_Hs02_00388229 predicted 47
3 SASI_Hs02_00388230 predicted 302
4 SASI_Hs02_00388231 predicted 316
5 SASI_Hs02_00388232 predicted 37
6 SASI_Hs02_00388233 predicted 37
7 SASI_Hs02_00388234 predicted 348
8 SASI_Hs02_00388235 predicted 267
9 SASI_Hs02_00388236 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00389687 predicted 83
2 SASI_Hs02_00389688 predicted 45
3 SASI_Hs02_00389689 predicted 305
4 SASI_Hs02_00389690 predicted 315
5 SASI_Hs02_00389691 predicted 38
6 SASI_Hs02_00389692 predicted 36
7 SASI_Hs02_00389693 predicted 343
8 SASI_Hs02_00389694 predicted 264
9 SASI_Hs02_00389695 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424927 predicted 85
2 SASI_Hs02_00424928 predicted 47
3 SASI_Hs02_00424929 predicted 305
4 SASI_Hs02_00424930 predicted 315
5 SASI_Hs02_00424931 predicted 46
6 SASI_Hs02_00424932 predicted 33
7 SASI_Hs02_00424933 predicted 341
8 SASI_Hs02_00424934 predicted 265
9 SASI_Hs02_00424935 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001131332
LOC730144 MISSION shRNA Bacterial Glycerol Stock
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-32s21c1
Sequence:CCGGACTGGACCATGGAACGCTTTCCTCGAGGAAAGCGTTCCATGGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-85s21c1
Sequence:CCGGTCGTATTGTAAGTTCGCTATCCTCGAGGATAGCGAACTTACAATACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-127s21c1
Sequence:CCGGCCCTTTGCTGATGCAAGTAAGCTCGAGCTTACTTGCATCAGCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-165s21c1
Sequence:CCGGTGCTGGCACTGAGGATTATATCTCGAGATATAATCCTCAGTGCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001131332
LOC730144 MISSION shRNA shRNA Plasmid DNA
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-32s21c1
Sequence:CCGGACTGGACCATGGAACGCTTTCCTCGAGGAAAGCGTTCCATGGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-85s21c1
Sequence:CCGGTCGTATTGTAAGTTCGCTATCCTCGAGGATAGCGAACTTACAATACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-127s21c1
Sequence:CCGGCCCTTTGCTGATGCAAGTAAGCTCGAGCTTACTTGCATCAGCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-165s21c1
Sequence:CCGGTGCTGGCACTGAGGATTATATCTCGAGATATAATCCTCAGTGCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001131332
LOC730144 MISSION shRNA Lentiviral Transduction Particles
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-32s21c1
Sequence:CCGGACTGGACCATGGAACGCTTTCCTCGAGGAAAGCGTTCCATGGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-85s21c1
Sequence:CCGGTCGTATTGTAAGTTCGCTATCCTCGAGGATAGCGAACTTACAATACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-127s21c1
Sequence:CCGGCCCTTTGCTGATGCAAGTAAGCTCGAGCTTACTTGCATCAGCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001131332.2-165s21c1
Sequence:CCGGTGCTGGCACTGAGGATTATATCTCGAGATATAATCCTCAGTGCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)