EMAIL THIS PAGE TO A FRIEND

LOC80154

110 Gene Product Result for
Species: Human LOC80154(80154)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025084 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025084 Rosetta Predictions human pricing
XR_040862 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165896 predicted 386
2 SASI_Hs01_00165897 predicted 935
3 SASI_Hs01_00165898 predicted 384
4 SASI_Hs01_00165899 predicted 731
5 SASI_Hs01_00165900 predicted 1022
6 SASI_Hs01_00165901 predicted 1037
7 SASI_Hs01_00165902 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522607 predicted 481
2 SASI_Hs02_00522608 predicted 479
3 SASI_Hs02_00522609 predicted 1086
4 SASI_Hs02_00522610 predicted 1149
5 SASI_Hs02_00522611 predicted 1052
6 SASI_Hs02_00522612 predicted 717
7 SASI_Hs02_00522613 predicted 1329
8 SASI_Hs02_00522614 predicted 322
9 SASI_Hs02_00522615 predicted 10
10 SASI_Hs02_00522616 predicted 1330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025084
VALIDATED
LOC80154 MISSION shRNA Bacterial Glycerol Stock
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025084.1-386s1c1
Sequence:CCGGGAGAAGCTGCAGGAAAGTACACTCGAGTGTACTTTCCTGCAGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1757s1c1
Sequence:CCGGCTATGAAGTGTGTTGTGGGATCTCGAGATCCCACAACACACTTCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025084.1-2157s1c1
Sequence:CCGGCGAGAAGAAAGGAAGAGAAATCTCGAGATTTCTCTTCCTTTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-2156s1c1
Sequence:CCGGGCGAGAAGAAAGGAAGAGAAACTCGAGTTTCTCTTCCTTTCTTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1750s1c1
Sequence:CCGGGCATGGCCTATGAAGTGTGTTCTCGAGAACACACTTCATAGGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1408s1c1
Sequence:CCGGCCCATAGACTTATAAGTCTAACTCGAGTTAGACTTATAAGTCTATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1402s1c1
Sequence:CCGGCCACTGCCCATAGACTTATAACTCGAGTTATAAGTCTATGGGCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025084
VALIDATED
LOC80154 MISSION shRNA shRNA Plasmid DNA
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025084.1-386s1c1
Sequence:CCGGGAGAAGCTGCAGGAAAGTACACTCGAGTGTACTTTCCTGCAGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1757s1c1
Sequence:CCGGCTATGAAGTGTGTTGTGGGATCTCGAGATCCCACAACACACTTCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025084.1-2157s1c1
Sequence:CCGGCGAGAAGAAAGGAAGAGAAATCTCGAGATTTCTCTTCCTTTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-2156s1c1
Sequence:CCGGGCGAGAAGAAAGGAAGAGAAACTCGAGTTTCTCTTCCTTTCTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1750s1c1
Sequence:CCGGGCATGGCCTATGAAGTGTGTTCTCGAGAACACACTTCATAGGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1408s1c1
Sequence:CCGGCCCATAGACTTATAAGTCTAACTCGAGTTAGACTTATAAGTCTATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1402s1c1
Sequence:CCGGCCACTGCCCATAGACTTATAACTCGAGTTATAAGTCTATGGGCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025084
VALIDATED
LOC80154 MISSION shRNA Lentiviral Transduction Particles
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025084.1-386s1c1
Sequence:CCGGGAGAAGCTGCAGGAAAGTACACTCGAGTGTACTTTCCTGCAGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154160    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1757s1c1
Sequence:CCGGCTATGAAGTGTGTTGTGGGATCTCGAGATCCCACAACACACTTCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025084.1-2157s1c1
Sequence:CCGGCGAGAAGAAAGGAAGAGAAATCTCGAGATTTCTCTTCCTTTCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-2156s1c1
Sequence:CCGGGCGAGAAGAAAGGAAGAGAAACTCGAGTTTCTCTTCCTTTCTTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196030    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1750s1c1
Sequence:CCGGGCATGGCCTATGAAGTGTGTTCTCGAGAACACACTTCATAGGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1408s1c1
Sequence:CCGGCCCATAGACTTATAAGTCTAACTCGAGTTAGACTTATAAGTCTATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025084.1-1402s1c1
Sequence:CCGGCCACTGCCCATAGACTTATAACTCGAGTTATAAGTCTATGGGCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)