EMAIL THIS PAGE TO A FRIEND

LOC81691

24 Gene Product Result for
Species: Human LOC81691(81691)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030941 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030941 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163494 predicted 833
2 SASI_Hs01_00163495 predicted 505
3 SASI_Hs01_00163496 predicted 2247
4 SASI_Hs01_00163497 predicted 847
5 SASI_Hs01_00163498 predicted 1114
6 SASI_Hs02_00358519 predicted 475
7 SASI_Hs02_00358520 predicted 385
8 SASI_Hs01_00163499 predicted 1032
9 SASI_Hs02_00358521 predicted 1054
10 SASI_Hs01_00163500 predicted 283
11 SASI_Hs01_00163501 predicted 1252
12 SASI_Hs01_00163502 predicted 1299
13 SASI_Hs01_00163503 predicted 2446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030941
VALIDATED
LOC81691 MISSION shRNA Bacterial Glycerol Stock
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030941.1-2531s1c1
Sequence:CCGGGCCATGTTTCCATGTGCCATTCTCGAGAATGGCACATGGAAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-766s1c1
Sequence:CCGGGCCTTCTGACAAAGGAGGAAACTCGAGTTTCCTCCTTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-2076s1c1
Sequence:CCGGGCTGTGATCTTGCCTAAAGATCTCGAGATCTTTAGGCAAGATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-1323s1c1
Sequence:CCGGGCTCGGTATTTCCTTAAGCATCTCGAGATGCTTAAGGAAATACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030941.1-392s1c1
Sequence:CCGGGCTGTGTGAATTGCTGAAGTACTCGAGTACTTCAGCAATTCACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030941.2-394s21c1
Sequence:CCGGAGGCCAAGAAAGCCCGCTTATCTCGAGATAAGCGGGCTTTCTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-2142s21c1
Sequence:CCGGGCTGTGATCTTGCCTAAAGATCTCGAGATCTTTAGGCAAGATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-1389s21c1
Sequence:CCGGGCTCGGTATTTCCTTAAGCATCTCGAGATGCTTAAGGAAATACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030941.2-832s21c1
Sequence:CCGGGCCTTCTGACAAAGGAGGAAACTCGAGTTTCCTCCTTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-1939s21c1
Sequence:CCGGTAGAATCCTTGGATGGTATTCCTCGAGGAATACCATCCAAGGATTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030941
VALIDATED
LOC81691 MISSION shRNA shRNA Plasmid DNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030941.1-2531s1c1
Sequence:CCGGGCCATGTTTCCATGTGCCATTCTCGAGAATGGCACATGGAAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-766s1c1
Sequence:CCGGGCCTTCTGACAAAGGAGGAAACTCGAGTTTCCTCCTTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-2076s1c1
Sequence:CCGGGCTGTGATCTTGCCTAAAGATCTCGAGATCTTTAGGCAAGATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-1323s1c1
Sequence:CCGGGCTCGGTATTTCCTTAAGCATCTCGAGATGCTTAAGGAAATACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030941.1-392s1c1
Sequence:CCGGGCTGTGTGAATTGCTGAAGTACTCGAGTACTTCAGCAATTCACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030941.2-394s21c1
Sequence:CCGGAGGCCAAGAAAGCCCGCTTATCTCGAGATAAGCGGGCTTTCTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-2142s21c1
Sequence:CCGGGCTGTGATCTTGCCTAAAGATCTCGAGATCTTTAGGCAAGATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-1389s21c1
Sequence:CCGGGCTCGGTATTTCCTTAAGCATCTCGAGATGCTTAAGGAAATACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030941.2-832s21c1
Sequence:CCGGGCCTTCTGACAAAGGAGGAAACTCGAGTTTCCTCCTTTGTCAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-1939s21c1
Sequence:CCGGTAGAATCCTTGGATGGTATTCCTCGAGGAATACCATCCAAGGATTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030941
VALIDATED
LOC81691 MISSION shRNA Lentiviral Transduction Particles
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030941.1-2531s1c1
Sequence:CCGGGCCATGTTTCCATGTGCCATTCTCGAGAATGGCACATGGAAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-766s1c1
Sequence:CCGGGCCTTCTGACAAAGGAGGAAACTCGAGTTTCCTCCTTTGTCAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-2076s1c1
Sequence:CCGGGCTGTGATCTTGCCTAAAGATCTCGAGATCTTTAGGCAAGATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030941.1-1323s1c1
Sequence:CCGGGCTCGGTATTTCCTTAAGCATCTCGAGATGCTTAAGGAAATACCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_030941.1-392s1c1
Sequence:CCGGGCTGTGTGAATTGCTGAAGTACTCGAGTACTTCAGCAATTCACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030941.2-394s21c1
Sequence:CCGGAGGCCAAGAAAGCCCGCTTATCTCGAGATAAGCGGGCTTTCTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-2142s21c1
Sequence:CCGGGCTGTGATCTTGCCTAAAGATCTCGAGATCTTTAGGCAAGATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-1389s21c1
Sequence:CCGGGCTCGGTATTTCCTTAAGCATCTCGAGATGCTTAAGGAAATACCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_030941.2-832s21c1
Sequence:CCGGGCCTTCTGACAAAGGAGGAAACTCGAGTTTCCTCCTTTGTCAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030941.2-1939s21c1
Sequence:CCGGTAGAATCCTTGGATGGTATTCCTCGAGGAATACCATCCAAGGATTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)